ID: 969663225

View in Genome Browser
Species Human (GRCh38)
Location 4:8542562-8542584
Sequence ACTTGCACCCAGGAGCGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969663225_969663229 13 Left 969663225 4:8542562-8542584 CCCTTCCGCTCCTGGGTGCAAGT No data
Right 969663229 4:8542598-8542620 CACACATGTGTGTCTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969663225 Original CRISPR ACTTGCACCCAGGAGCGGAA GGG (reversed) Intergenic
No off target data available for this crispr