ID: 969664231

View in Genome Browser
Species Human (GRCh38)
Location 4:8547940-8547962
Sequence AGTCTCATTCCCATGAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969664226_969664231 10 Left 969664226 4:8547907-8547929 CCTAGCAGAGCCTGCAGGCTCTC No data
Right 969664231 4:8547940-8547962 AGTCTCATTCCCATGAGATCAGG No data
969664223_969664231 17 Left 969664223 4:8547900-8547922 CCCAGGGCCTAGCAGAGCCTGCA No data
Right 969664231 4:8547940-8547962 AGTCTCATTCCCATGAGATCAGG No data
969664229_969664231 0 Left 969664229 4:8547917-8547939 CCTGCAGGCTCTCAGAGCAGGGG No data
Right 969664231 4:8547940-8547962 AGTCTCATTCCCATGAGATCAGG No data
969664224_969664231 16 Left 969664224 4:8547901-8547923 CCAGGGCCTAGCAGAGCCTGCAG No data
Right 969664231 4:8547940-8547962 AGTCTCATTCCCATGAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969664231 Original CRISPR AGTCTCATTCCCATGAGATC AGG Intergenic
No off target data available for this crispr