ID: 969666455

View in Genome Browser
Species Human (GRCh38)
Location 4:8560213-8560235
Sequence CCTCCCTCGCTCCCATGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969666455 Original CRISPR CCTCCCTCGCTCCCATGGAC AGG Intronic
900265023 1:1753128-1753150 CCTCCCTCCCTCCCTGGGAATGG + Intronic
900577750 1:3392106-3392128 CCTCTCTCTCTCCCAAGGCCAGG + Intronic
904036811 1:27563506-27563528 CCTCCCCGGCTGCCTTGGACAGG + Intronic
904237317 1:29123766-29123788 CCTCCCTCCCTCCCTCGGTCAGG - Intronic
904303979 1:29575203-29575225 CCTCCCTCCCACCCATGGGGTGG + Intergenic
904418029 1:30374682-30374704 CCTCCCGTGGTGCCATGGACGGG + Intergenic
904931288 1:34089317-34089339 CCTCCCTCGGTGCCAAGTACAGG - Intronic
906516504 1:46442242-46442264 CATCCCTGGGTCCCATGCACAGG + Intergenic
907319987 1:53596078-53596100 CCACCCTCGCTCTCATGGGGAGG - Intronic
907419225 1:54335699-54335721 CCTCCCTGGCTCCTGAGGACAGG - Intronic
907419935 1:54340463-54340485 CCTCCCTGCCACCCCTGGACAGG - Intronic
907524687 1:55047187-55047209 CCTCCCTCCCTTCCATAGCCAGG - Intronic
908624077 1:66020463-66020485 CCTCCCCCCACCCCATGGACAGG + Intronic
910058059 1:83055504-83055526 CCTCCCTGGCTCCAGTGGGCTGG - Intergenic
912804466 1:112744264-112744286 CCTCTCTCGCTCCCAGGGCCTGG + Intergenic
916262991 1:162861196-162861218 CCTCCCTACCTCCCCTGGTCAGG + Intronic
916352563 1:163868050-163868072 CCTCCTTGGCTCCCATAGAAGGG - Intergenic
921607110 1:217168761-217168783 CCTGCCTCGGTACCAGGGACAGG - Intergenic
922792297 1:228317138-228317160 CCTCCCAGACTCCCATGGTCAGG - Intronic
924056835 1:240132489-240132511 CCTACCTCTCCACCATGGACTGG - Intronic
924295670 1:242585139-242585161 CCTGCCTCACTTCCATGGGCTGG - Intergenic
1066656902 10:37704976-37704998 CCTCCATTGCTCCCCTGAACAGG - Intergenic
1069899774 10:71700787-71700809 CCTCCCCAGGACCCATGGACAGG + Intronic
1069996147 10:72343301-72343323 CCTTACTCCCTGCCATGGACAGG + Intronic
1070665759 10:78342317-78342339 CCTCCCTCCCTCCCAGGCCCAGG - Intergenic
1073154462 10:101335493-101335515 CCACCCTCCCTTCCATGGCCAGG - Intergenic
1073566255 10:104538089-104538111 CCTCCCTCTCACCCAGGGTCAGG + Intergenic
1075426657 10:122347053-122347075 CCTCCCTCCCTCTCTGGGACAGG - Intergenic
1075495512 10:122915726-122915748 CCTCTCTCTCTTCCATGGCCAGG - Intergenic
1075670498 10:124261004-124261026 CCTCCTTCACTCCAATGGAGAGG + Intergenic
1075731967 10:124641713-124641735 CCTCTCTGGCTCCCAAGGAAGGG - Intronic
1075880559 10:125847221-125847243 CCTCCCTCCCTTCCATGGTATGG - Intronic
1076911421 10:133392090-133392112 ACTCCCTGGCTCCCATGGGCTGG - Intronic
1077082099 11:728758-728780 CCTCCCTCACTTCCAAGGACTGG - Intergenic
1081732842 11:45383813-45383835 CCTCCCTCCCTCCTTTGCACTGG + Intergenic
1082862745 11:57871372-57871394 CCTCCCTCCCTCCCAGAGATGGG + Intergenic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1083714290 11:64567020-64567042 GCTCCCACGCTCCCAGGGGCTGG - Intronic
1083990220 11:66242170-66242192 CCTGCCTCACTCCCACGCACAGG - Intronic
1084319402 11:68365161-68365183 CCCCCCACGCTCCAATGGCCGGG - Intronic
1085184397 11:74563170-74563192 CCTCCTTCCCTTCCAAGGACTGG - Intronic
1085450512 11:76629440-76629462 CTTCTCTGGCTCCCATGGCCTGG - Intergenic
1085738147 11:79057236-79057258 CCTCCGTGGCTCCCCTGCACTGG + Intronic
1089090327 11:115869431-115869453 CCACCCTGGATCCCAAGGACAGG - Intergenic
1089153014 11:116378892-116378914 CCTTCCTCCCTTCCATGGACTGG - Intergenic
1089176063 11:116549718-116549740 CCTCCCTCCCTCCCAGGAATGGG + Intergenic
1089681699 11:120122252-120122274 CCTCCCTCTCCCACATGCACAGG + Intronic
1091021714 11:132105885-132105907 CCTCCCTCCCACACATGCACAGG - Intronic
1091340210 11:134806264-134806286 CTTCCCACGCTCCCAGTGACTGG + Intergenic
1091402386 12:188909-188931 CCTCCATCGCTCCCATTCTCTGG - Intergenic
1091754324 12:3041692-3041714 CCTCCCTCCCTCCCATGGGGAGG + Intergenic
1091822946 12:3490439-3490461 CCTCCCTCTCTCCCATAAAAGGG + Intronic
1096040530 12:48511741-48511763 ACTCCATCGCCCCCATGGCCTGG + Intronic
1102565468 12:113794665-113794687 TCTCCCTCTCTCTCAAGGACAGG + Intergenic
1104024059 12:125013572-125013594 CCTCCCTCGCAGCTAGGGACTGG - Intronic
1105281018 13:18962674-18962696 CCCACCTCGCTCCCATGAACAGG + Intergenic
1105290220 13:19048686-19048708 CCGACCTCGCTCCCATGAACGGG + Intergenic
1107263081 13:38518786-38518808 CCTCCCTCGTACCCAGGGCCAGG - Intergenic
1108691946 13:52867101-52867123 CTTCCCTGGCTCCCATGGCTAGG + Intergenic
1113631010 13:111883861-111883883 CCTGCCTGCCTCCCATGGTCTGG - Intergenic
1113743270 13:112725409-112725431 CCTCCTTCGCCCCCATCGCCTGG + Intronic
1113962124 13:114132159-114132181 CCTCCGCCGCTACCAGGGACCGG + Intronic
1114293908 14:21312348-21312370 CGCCCCTCCCTGCCATGGACAGG + Intronic
1114788651 14:25630187-25630209 ACTCCCTCGCTCACATGCAAAGG + Intergenic
1114831566 14:26148773-26148795 CCTCCCTCCCATCCCTGGACAGG - Intergenic
1114866015 14:26597192-26597214 CCTCCCTCCCTCCCGCGGCCCGG - Intronic
1117851441 14:59975501-59975523 ACTCCCTGGTACCCATGGACTGG + Intronic
1119732914 14:76962489-76962511 CCTCCCTGGCTCCCCAGGGCTGG - Intergenic
1121636216 14:95455511-95455533 GCTCCCAGGCTCCCCTGGACCGG + Exonic
1123076400 14:105669444-105669466 CCTGCCTTGCTGCCCTGGACTGG + Intergenic
1123091105 14:105742670-105742692 CCTGCCTTGCTGCCCTGGACTGG + Intergenic
1126787220 15:52186972-52186994 CCTGCCTCCCTCCCAGGGAGAGG - Intronic
1127679558 15:61279962-61279984 CCTCCTTCACTCCCAGGGAATGG + Intergenic
1128523454 15:68390756-68390778 CCTGCCTAGCTCCCTGGGACAGG + Intronic
1132023235 15:98382776-98382798 CCTCCATCCTTCCCATGGCCAGG + Intergenic
1132635631 16:944638-944660 CCTGCCACTCTGCCATGGACGGG + Intronic
1132713626 16:1279956-1279978 CCTCCCTCGCCCACATCCACGGG + Intergenic
1133181208 16:4056007-4056029 CTTCCTTAGCTCCCATAGACAGG + Intronic
1135091602 16:19522179-19522201 CCTCCCCCGTTGCCATGGAGCGG - Intergenic
1135327310 16:21534921-21534943 CCTCCCTGGCTCCCCTGCTCAGG + Intergenic
1136337659 16:29620944-29620966 CCTCCCTGGCTCCCCTGCTCAGG + Intergenic
1138399695 16:56735498-56735520 CCTCACTGGCTCCCATTCACAGG - Intronic
1139705574 16:68738197-68738219 CCTCCCTCGCTCCCGGCGTCGGG - Intronic
1140879835 16:79187975-79187997 CCACTCTCTCTCCCATGCACGGG + Intronic
1140988105 16:80178673-80178695 CCTTCCTTGCTCTCAAGGACTGG - Intergenic
1142040417 16:87890092-87890114 CCTCCCTGGCTCCCCTGCTCAGG + Intronic
1143100420 17:4501528-4501550 CCTCCCTCCCTCTCCTGGCCTGG + Intronic
1143741642 17:8958634-8958656 CCTCCCAAGTTCCCAGGGACAGG - Intronic
1144276050 17:13668672-13668694 CCACCCTAGATCCCAAGGACAGG + Intergenic
1145102722 17:20090130-20090152 CCTGCCCAGCTCCCATGGCCCGG - Intronic
1146619608 17:34387234-34387256 CCTCCCCTGCTCCCACTGACTGG - Intergenic
1146797903 17:35795616-35795638 CCTCCCTCGGTCCCCGGGGCCGG - Intronic
1147168917 17:38606852-38606874 CCTCCCTCGCTCCGATGCTCTGG + Intergenic
1147323146 17:39657951-39657973 CCTCCCTCCCTCCCCTGGGCAGG + Exonic
1151274104 17:73021022-73021044 ACTCCCTCCCTCCCATGAATTGG + Intronic
1151573446 17:74938823-74938845 CCTTCCTTGCTCTCTTGGACTGG - Intronic
1151658808 17:75508063-75508085 CCTCCCTCCAGCCCAGGGACAGG + Intronic
1152636462 17:81432551-81432573 CCACCCTCCCTCCCATCGCCGGG + Intronic
1152755810 17:82086553-82086575 CCTCCCTCCCTCCCCAGGGCTGG - Exonic
1157238487 18:45986610-45986632 CCTCCCTCTTTCTCATGGAAAGG - Intronic
1157673541 18:49550834-49550856 CCTGCCTCACTCCCAGGGACAGG - Intergenic
1157675936 18:49568794-49568816 CCTTCCTTGTTCCCATGGAATGG + Intronic
1160408082 18:78656500-78656522 CCTCCCTCGCTCCCACATGCAGG + Intergenic
1161939061 19:7391265-7391287 CCTCCGTCTGTCCCACGGACGGG - Intronic
1161968386 19:7561584-7561606 CCTCCCTCCCACCCCTGGACTGG + Exonic
1162030395 19:7914750-7914772 CCTCCCTCCTTGCCAAGGACAGG + Intergenic
1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG + Intergenic
1163393650 19:17046076-17046098 CCTCCCTCCCTGCCCTGGATGGG + Intergenic
1163612815 19:18309909-18309931 CCTCCCGCGCTCCCAGGGCTGGG - Intronic
1164754561 19:30680003-30680025 CCTCCCTCCCTCCCCTGGCCTGG - Intronic
1164775976 19:30854146-30854168 CCTGCCTCGAACCCATGGAGTGG - Intergenic
1166352074 19:42203989-42204011 CCCCCCACCCTCCCAGGGACAGG - Intronic
1167473392 19:49687389-49687411 CCACCCTCGCACCCATCGGCCGG - Intronic
1167691134 19:50984085-50984107 CCACCCTCCCTCCGAAGGACGGG + Intronic
1167721438 19:51182803-51182825 TCTCCCTCCCTCCCCAGGACCGG - Intergenic
1167763538 19:51463967-51463989 TCTCCCTCCCTCCCCAGGACCGG + Intergenic
931801473 2:65762285-65762307 CCTCCCCCGCTGCCCTGGAATGG - Intergenic
936918652 2:117665142-117665164 CCTCTCTCTCTCCCATCCACAGG - Intergenic
944667932 2:201972329-201972351 CCTCCCTGCCTCCCAGGGACAGG - Intergenic
948741406 2:240048923-240048945 CCTTCTTCCCTCCCATGGGCAGG - Intergenic
1172386160 20:34535545-34535567 CCTCGCTCTCACTCATGGACTGG + Intronic
1173912749 20:46682459-46682481 CCTCTCTTGGCCCCATGGACTGG + Intronic
1176087128 20:63302854-63302876 CCACCCTGTCTCCCATAGACTGG + Intronic
1179800547 21:43809762-43809784 CCACCCTCGATCCCACGGCCAGG - Intergenic
1180959622 22:19756737-19756759 CCTCCCTCCCTCACCTGGCCCGG - Exonic
1181788547 22:25245027-25245049 CCTCCGTGGCTTCCATGGCCAGG + Intergenic
1181820238 22:25469716-25469738 CCTCCCTGGCTTCTATGGCCAGG + Intergenic
1183302856 22:37066795-37066817 CCTCTCTCCCTCCCATGCCCGGG + Intronic
1185253054 22:49815794-49815816 CCTCCCGAGCTCCCAGGCACTGG + Intronic
951464959 3:22991041-22991063 CCTCCCACACTCCCATAGGCTGG - Intergenic
951551507 3:23879646-23879668 CCTCCCTGGTGCCCACGGACAGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954390016 3:50263802-50263824 CCTCCCTCCCTCCCCTGGGTGGG - Intergenic
956286301 3:67613977-67613999 CCTCCCTCCCTCCCAAAGCCTGG - Intronic
961780365 3:129317132-129317154 CCTCCCCCTCTCCCGTGCACAGG + Intergenic
965695023 3:171399344-171399366 CCTCCCTCCCTCCCAGAGGCAGG + Intronic
966292091 3:178371421-178371443 CTTTCCTTTCTCCCATGGACAGG - Intergenic
969645871 4:8428471-8428493 CCTCCGTCCGTCCCATGGGCGGG + Intronic
969666455 4:8560213-8560235 CCTCCCTCGCTCCCATGGACAGG + Intronic
969704178 4:8783067-8783089 CCTCCCTCCCTCCCGGGGATGGG + Intergenic
969722070 4:8897666-8897688 CCTCCCTCTCTTCCTTTGACTGG + Intergenic
972692238 4:41410676-41410698 TCTCACTGGATCCCATGGACGGG - Intronic
975342658 4:73258862-73258884 CCTCCCTCCCTCCCATCGTCAGG - Intergenic
978073084 4:104494880-104494902 CCTCCCTCGCACACAGCGACTGG - Exonic
986616711 5:9624821-9624843 CCTCTCTCCCTCCCATGGATCGG - Intergenic
991041651 5:62182514-62182536 CCTCCCAGGCCCCCATGGGCAGG + Intergenic
999257103 5:150215832-150215854 CCTCCCTAGCTCCCGTGGCATGG - Intronic
1002524028 5:179805989-179806011 CCTCCCTCCCTCCCACAGGCCGG + Intronic
1003679838 6:8242005-8242027 CTTCCCTCTGTCCCATGGAAGGG + Intergenic
1004201762 6:13555136-13555158 CTTCCCTCCCTCCCATGGGCTGG - Intergenic
1006082543 6:31575714-31575736 CCACCCTCTCTCCCCTGGAAAGG + Exonic
1007494788 6:42252373-42252395 CCTCCCGCCCTGACATGGACAGG + Intronic
1007633828 6:43286472-43286494 CCTCCCTCCCTCCCACAGGCGGG - Exonic
1013746478 6:113352448-113352470 CCTGCCTAGTTTCCATGGACTGG + Intergenic
1015606364 6:134959060-134959082 ACTCCCTGGCTCCCTTGGCCAGG - Intergenic
1017720615 6:157240905-157240927 CCTCCCTCCCTCCCCAGGGCTGG - Intergenic
1017830709 6:158126463-158126485 CCTCCCTCCCTTCTATGGACAGG - Intronic
1019558196 7:1642794-1642816 CCTCCCTCCCTCCCATGCTACGG + Intergenic
1019661252 7:2225236-2225258 GCCCCCTTGCTCCCAGGGACTGG + Intronic
1019792832 7:3028321-3028343 CCACCCCCTCTCCCATGGAATGG + Intronic
1021037070 7:15812668-15812690 CCTTCCTCGCTCCCCTGCTCTGG + Intergenic
1022376384 7:29815557-29815579 CCTCCCTAGATCCTATGGACAGG - Intronic
1022952359 7:35351062-35351084 TCTCTCTCACTCCCATGGAAGGG + Intergenic
1023722892 7:43113482-43113504 CGGCCCTTGCTCCCATGGACGGG + Intronic
1024672299 7:51607201-51607223 CCTCCCTGGCCACCAAGGACAGG - Intergenic
1030239809 7:107309896-107309918 ACCCCCTCTCTCCCAAGGACTGG + Intronic
1031901431 7:127415346-127415368 CCTCCCTACCTCCCCTGGACAGG - Intronic
1032313479 7:130811811-130811833 TATCCCTCTCTCCCATGCACTGG - Intergenic
1035583585 8:755633-755655 CCTCCCTCTCTCCCTGGGCCTGG - Intergenic
1036771253 8:11579629-11579651 CCTACCTCCCTACCATGGCCTGG + Intergenic
1039062349 8:33581729-33581751 CCTCTCTGGTTCCCAAGGACAGG + Intergenic
1039446722 8:37638995-37639017 CCACCCTCACTCCCTTGGGCAGG + Intergenic
1039830465 8:41209657-41209679 ACTCCCTCACTCCCAAGGAAAGG - Intergenic
1042321645 8:67481812-67481834 CCTGCCTCCCTCCCAGGGTCAGG - Intronic
1044667096 8:94641872-94641894 CCTCCCTCGCTCCCCTGCTGGGG - Intronic
1045680537 8:104654959-104654981 CCTCCCTTCCTGTCATGGACAGG - Intronic
1049343418 8:142126022-142126044 CCTCCCTCTCTCCCCAAGACTGG + Intergenic
1049346375 8:142141293-142141315 GCTCCCTGGCCCCCATGGATGGG + Intergenic
1053123162 9:35560859-35560881 CCTCCATCCCTACCATGGGCAGG - Intronic
1056401077 9:86227764-86227786 GCTCACTCTCTCCCATGGAGAGG - Intronic
1056926903 9:90843163-90843185 CCTCCCTGGCTCCCGAGGCCTGG - Intronic
1057271824 9:93655883-93655905 CCCACCTTGCTCCCATGAACGGG - Intronic
1057306529 9:93915652-93915674 CCTCCCTCCATCCCTGGGACAGG - Intergenic
1057443036 9:95095785-95095807 CCTTCCTCCCTCCAAAGGACTGG + Intergenic
1058759607 9:108118297-108118319 CCTCCCTGTCTCCCAGGGACAGG - Intergenic
1060827567 9:126695580-126695602 CCTCCCTGGATCCCCTGGAGGGG + Intronic
1061382225 9:130265542-130265564 CATCCCTCGCTGCCCTGGCCGGG + Intergenic
1061923573 9:133795203-133795225 CCTCCCTCTCTCCCCTTGTCCGG - Intronic
1187486245 X:19706971-19706993 CCTCCGTCGCTCGCCTGGATGGG + Exonic
1192788125 X:74354355-74354377 CCTGCCTGGCCCCTATGGACAGG + Intergenic
1194928194 X:99853686-99853708 CCTCCCTCGTTCCCATGTTTTGG + Intergenic
1197815056 X:130489467-130489489 CCTACCTCTCTCCCAAGCACTGG + Intergenic
1200064670 X:153498657-153498679 CCTCCCTCCCTCCCTGGTACAGG - Intronic