ID: 969666665

View in Genome Browser
Species Human (GRCh38)
Location 4:8561262-8561284
Sequence CACAGGAAAGTGCCTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969666665 Original CRISPR CACAGGAAAGTGCCTAGGCT GGG Intronic
901828639 1:11878962-11878984 CACAGGAAGGAGGCTGGGCTGGG - Intergenic
902877946 1:19352232-19352254 CACAGGCAAGTGCCTCTACTGGG + Intronic
903125907 1:21247446-21247468 CAAAGGAAAGAGCTTGGGCTTGG + Intronic
903592277 1:24466173-24466195 CACAGGAAAGGGCCAAGGCCTGG - Intronic
904960378 1:34327980-34328002 TGCAGCACAGTGCCTAGGCTGGG + Intergenic
910697012 1:90030093-90030115 TACAGGATAGTCCCTAGGCATGG - Intronic
911358494 1:96849149-96849171 CACATGGAAGTGCCAAGGTTTGG - Intergenic
912904657 1:113691428-113691450 CAGAAGAAAGTGCCTATTCTGGG + Intergenic
913978573 1:143487880-143487902 CGCAGGAAATTGGCTAGGGTGGG - Intergenic
914072984 1:144313528-144313550 CGCAGGAAATTGGCTAGGGTGGG - Intergenic
914106170 1:144652832-144652854 CGCAGGAAATTGGCTAGGGTGGG + Intergenic
915278930 1:154809130-154809152 CACAGGAGAGTGCTGAGGCATGG - Intronic
915910992 1:159915379-159915401 CACAGGCTGGTGCCTAGTCTGGG + Intergenic
916517534 1:165533451-165533473 CTCCGGAAACTGCCTTGGCTGGG - Intergenic
916566588 1:165984047-165984069 CTCTGGAAATTTCCTAGGCTCGG + Intergenic
917868433 1:179220470-179220492 CACAGGACAGTGCCTTGTTTAGG + Intronic
918799425 1:188953533-188953555 CAGAGCAAAGTACCTAGGCTGGG - Intergenic
921049669 1:211502013-211502035 CACAGGGAGGTGCCCAGCCTCGG - Intergenic
1063573052 10:7234413-7234435 CACAGGTATGTGCCCAGGATGGG + Intronic
1063580941 10:7306261-7306283 CACAGGCAAGTGCCGGGGGTGGG - Intronic
1065884974 10:30068851-30068873 CAAGGGAAAGAGCCTAGGATTGG - Intronic
1067786882 10:49256686-49256708 CCCAGGAAACTGCCTACACTGGG - Intergenic
1068917655 10:62449975-62449997 CACAGAAAAGAGTGTAGGCTGGG + Intronic
1070237769 10:74648382-74648404 GAAAGGAAAATGCCTAGGCCGGG + Intronic
1072767695 10:98109095-98109117 CACAGGAAAAGCCCTGGGCTAGG + Intergenic
1072800645 10:98390332-98390354 CCCAGGAAAGTGCTGGGGCTGGG - Intronic
1072805683 10:98422871-98422893 CACAGTGAGGTGCATAGGCTGGG - Intronic
1073044425 10:100628482-100628504 GGCAGGTCAGTGCCTAGGCTGGG + Intergenic
1074320636 10:112398693-112398715 AATAGGAAAGTGGCTGGGCTCGG - Intronic
1074756303 10:116627005-116627027 CACAGGACAGGGCCCAGGCAGGG - Intronic
1074965831 10:118490083-118490105 CACATGGAAGCGCCAAGGCTTGG - Intergenic
1075355938 10:121775759-121775781 CACAGGACAGTAACTTGGCTGGG + Intronic
1077020511 11:415179-415201 CAGAGGAAAGTGCCGTGCCTGGG - Intronic
1078444075 11:11391045-11391067 CAAAGGAAGGTCCCTAGGCTGGG + Intronic
1078580752 11:12537883-12537905 CAGAGGGAAGTGTCAAGGCTTGG - Intergenic
1080010522 11:27454335-27454357 CACAGGCAAGTCCTTAGCCTTGG + Intronic
1080596499 11:33778298-33778320 CTGAGAAATGTGCCTAGGCTGGG - Intergenic
1081621849 11:44623526-44623548 CACAGGAAGGGGCCTTGGATGGG - Intergenic
1082793490 11:57363751-57363773 CACAGGAGAGTGCAGAAGCTGGG + Intronic
1084013088 11:66363474-66363496 CACAGGAAAGTCCCAGGGCCAGG + Exonic
1084579869 11:70016518-70016540 CACAGGACAGTGGCCAGCCTGGG + Intergenic
1085824216 11:79826148-79826170 AAGAGGAAAGTGGCTGGGCTTGG - Intergenic
1086842463 11:91704500-91704522 CAAAGGAAACAGCCTAGGGTAGG + Intergenic
1088213990 11:107487347-107487369 GACAGGGATGTGACTAGGCTTGG + Intergenic
1089184902 11:116608240-116608262 CATTGGAAAGTATCTAGGCTGGG - Intergenic
1090681463 11:129062837-129062859 TACAGAAAAGGGCCTAGGATGGG + Intronic
1092082899 12:5732860-5732882 CCCAGGAACGTGCCCAGGTTTGG - Intronic
1093166040 12:15805158-15805180 CAAAAGAAAATGCCAAGGCTGGG + Intronic
1095773874 12:45991228-45991250 CATGGGAAAGCCCCTAGGCTCGG - Intronic
1096608112 12:52781772-52781794 AACTGGAAAGTGGCAAGGCTGGG - Intergenic
1096614952 12:52826961-52826983 GACAGGAAAGGGCCCAGGCTTGG + Intronic
1096647477 12:53046755-53046777 CACAGGAGTGTGCCTGGGCTTGG - Intergenic
1097099083 12:56573585-56573607 TAAAGGAGAGTTCCTAGGCTTGG + Intronic
1099768487 12:87021317-87021339 CACAGAGATGTGCCTAGGCATGG - Intergenic
1101595483 12:106160854-106160876 CACAGGAATAAGCCTGGGCTAGG + Intergenic
1104050670 12:125191443-125191465 CACAGACCAGTGCCTGGGCTGGG - Intronic
1105220756 13:18323515-18323537 CGCAGGAAATTGGCTAGGGTGGG + Intergenic
1105280734 13:18961138-18961160 CAGAGGGAAGTGCCCAGGATGGG - Intergenic
1105644567 13:22303329-22303351 ATGTGGAAAGTGCCTAGGCTTGG + Intergenic
1108587775 13:51885742-51885764 CAAAGGGAAGTGCCTAGGAGGGG - Intergenic
1109512796 13:63401783-63401805 CTGATGAAAGTGCCTGGGCTAGG + Intergenic
1111465693 13:88606404-88606426 CACAGGTAAGTGCCCACTCTCGG + Intergenic
1113149065 13:107241944-107241966 CATAAAAAAGTGCCTTGGCTGGG + Intronic
1113608846 13:111629088-111629110 CACAGGAAAGTGGGCAGGGTGGG + Intronic
1113776448 13:112948773-112948795 CACAGAAAAGTGGCTGGGCATGG + Intronic
1114166217 14:20221047-20221069 CACAGTCATGTGCATAGGCTGGG - Intergenic
1114200173 14:20512804-20512826 CATAGGAATCTGCCTTGGCTGGG - Intergenic
1117003920 14:51399064-51399086 CACAGGAAAAGGGCTTGGCTAGG - Intergenic
1117062776 14:51980318-51980340 CAGTGGACAGTGCCCAGGCTTGG + Intergenic
1120869701 14:89325865-89325887 GACAGGACAGGGGCTAGGCTTGG - Intronic
1121895875 14:97647113-97647135 CACAGGAAAGTGCACAGCCTTGG - Intergenic
1122044189 14:99011753-99011775 GACAGCACAGTGCCTAGGCAGGG + Intergenic
1122522134 14:102352204-102352226 CACAGGAAAGAGCAGAGGATTGG - Intronic
1122902792 14:104788732-104788754 CCCAAGCAGGTGCCTAGGCTGGG - Intronic
1123685870 15:22796827-22796849 CACAGTAAAGAGCCCCGGCTGGG - Intronic
1123906058 15:24922269-24922291 CACATGAAAGTGGCAGGGCTGGG + Intronic
1125522291 15:40354952-40354974 CACAGGAAAGCGCCCAGCCCTGG + Intronic
1125606141 15:40941040-40941062 TACAGGAGATTTCCTAGGCTTGG + Intergenic
1126825080 15:52540484-52540506 CACAGGAAATTGCCAAAGCTTGG + Intergenic
1127728829 15:61779281-61779303 CACAGGAAAGTTCCTACATTAGG - Intergenic
1129696674 15:77744160-77744182 CAGAGGAAAGAGCATAGGTTTGG + Intronic
1131453133 15:92562758-92562780 CGCAGGAAAGTGGCGAGGGTTGG + Intergenic
1131718564 15:95141442-95141464 CACTGAAAAGTGGCTAGGCCAGG - Intergenic
1132649551 16:1014318-1014340 CACAGGACTGAGCCTAGGATGGG - Intergenic
1133387869 16:5385208-5385230 CACTGGAAAGTGGCAAGGCCAGG + Intergenic
1134630186 16:15750597-15750619 CACAGGATAGTGCCAAGCCAAGG - Intronic
1134882491 16:17757916-17757938 CTCAGGAAAGTGCTGAGGCATGG + Intergenic
1135146584 16:19967902-19967924 CACAGAACAGTGCCTAGACATGG - Intergenic
1140206407 16:72937181-72937203 TACAGGAAGAGGCCTAGGCTAGG + Intronic
1142477752 17:199715-199737 CACAGGTGAGAGCCTTGGCTGGG + Intergenic
1142760720 17:2040522-2040544 CAAAGGAAAGGCCCAAGGCTCGG - Exonic
1146277663 17:31525482-31525504 CAGAGAAAAGGGCCTGGGCTGGG + Intronic
1146473978 17:33146911-33146933 CACAGGAAAGTGGCTCAGGTTGG - Intronic
1147602579 17:41755364-41755386 GACAGAAAAGTGCCTGAGCTGGG - Exonic
1148979307 17:51558127-51558149 CACAGGGAATTGACTAGGGTTGG - Intergenic
1151319129 17:73342277-73342299 CAATGGAAAGTCCCTGGGCTCGG + Intronic
1151842021 17:76625727-76625749 CATAGGACAGTGCATGGGCTGGG - Intronic
1153922933 18:9807150-9807172 CACAGCAAAGTGCAGAGTCTAGG + Intronic
1155065915 18:22268659-22268681 CAGAGGAAAGTGGCGGGGCTAGG - Intergenic
1155735877 18:29221672-29221694 CACAGGACAGTGTCTAGGAATGG + Intergenic
1160686904 19:441092-441114 CGCAGGACAGTGTCAAGGCTGGG - Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1166063428 19:40341975-40341997 CAGAGGAATGTTCCTGGGCTAGG + Intronic
1166408674 19:42541815-42541837 CCCTGGAAAGGCCCTAGGCTGGG + Intronic
1166529154 19:43532415-43532437 GACTAGAAAGTGCCTAGGCCGGG - Intronic
1167299915 19:48672387-48672409 CCCAGGAATGTCCCTGGGCTGGG + Intronic
1167677185 19:50894633-50894655 CAGAGGAAAGGGCTTGGGCTAGG - Intergenic
925192237 2:1893923-1893945 CTGAGGACAGTGCCCAGGCTGGG + Intronic
925199081 2:1951496-1951518 CACAGGAAAGAGAGAAGGCTGGG + Intronic
926039334 2:9660233-9660255 CACAGGAAGGTGTCTTAGCTTGG - Intergenic
926171171 2:10553432-10553454 AACAGGAAAAAGCCCAGGCTGGG + Intergenic
926299182 2:11590050-11590072 GAGAGGAAAGTGCCAAGGTTTGG + Intronic
926922380 2:17951822-17951844 CCCAGGAATGTGCATGGGCTGGG + Intronic
927938360 2:27087721-27087743 GAGAGGCAAGTGCATAGGCTTGG - Intronic
932401248 2:71482475-71482497 CACAGGGAAGCGCCCAGGCCGGG - Intronic
934183299 2:89648960-89648982 CGCAGGAAATTGGCTAGGGTGGG - Intergenic
934293581 2:91723131-91723153 CGCAGGAAATTGGCTAGGGTGGG - Intergenic
936049208 2:109210606-109210628 CTCAGGGAAGTGCCTGGGCCTGG + Intronic
937577182 2:123437825-123437847 CACACGAAGGTTCCTGGGCTAGG + Intergenic
937933856 2:127226746-127226768 CACAGACAAGAGCCTGGGCTGGG - Intergenic
938134851 2:128748472-128748494 CACAGAAAAGTGCCTGGGAGTGG + Intergenic
940547176 2:155102486-155102508 CACATGAAACTGCCAAGGCTGGG + Intergenic
941211593 2:162646837-162646859 TCCAGGAAAGAGCCCAGGCTGGG + Intronic
941653373 2:168117618-168117640 CACAGAAAAGATGCTAGGCTGGG + Intronic
943763181 2:191631858-191631880 CAGAGAAAAGTAGCTAGGCTAGG + Intergenic
945190433 2:207181991-207182013 AACAGGACAGGGCCTAGGGTAGG + Intergenic
945281111 2:208036420-208036442 TGCAGGACAGGGCCTAGGCTGGG - Intergenic
946346343 2:219113992-219114014 GACAGGGAAGTTTCTAGGCTAGG + Intronic
946905880 2:224415538-224415560 CAGAGGGAAGGGCCTAGTCTAGG + Intergenic
1169484339 20:6014029-6014051 AACAGAAAAGTACCTAGCCTGGG - Intronic
1170711594 20:18796288-18796310 CACAGGACAGTGTCAAGCCTTGG - Intergenic
1172060612 20:32184722-32184744 CACAGGATAATGCCTTGGCTTGG + Intergenic
1172435438 20:34925922-34925944 CACTGGAATGTGCCTAGAGTAGG + Intronic
1172947268 20:38699303-38699325 CAAAAGAAGGAGCCTAGGCTGGG + Intergenic
1173223536 20:41147979-41148001 AACAGGAGAGTGGCTTGGCTTGG + Intronic
1173574069 20:44098877-44098899 GAAAGGAAAGTGCCTTGGATTGG - Intergenic
1175218332 20:57403127-57403149 CACTGGAAAATGCCTAGGGACGG - Intronic
1179475593 21:41641476-41641498 GGCAGGGAAGTGCCTGGGCTGGG + Intergenic
1181171135 22:21010849-21010871 GACAGCAGTGTGCCTAGGCTAGG - Intronic
1181178210 22:21049670-21049692 GACAGCAGTGTGCCTAGGCTAGG + Intronic
1181488879 22:23248988-23249010 AAGAGGAAAGGGCCTTGGCTGGG + Intronic
1181851917 22:25755494-25755516 CACAGGAAAGTGGCTGGGCGCGG - Intronic
1182129305 22:27839284-27839306 GACAGGAAGCTGCCCAGGCTGGG - Intergenic
1183450717 22:37893403-37893425 CAGAGCAAAGTGTGTAGGCTTGG + Intergenic
1184210122 22:43030481-43030503 CACAGGCAAGTGCCTTTCCTGGG - Intergenic
1184912771 22:47547387-47547409 GACAGGATGGTGCCTTGGCTGGG - Intergenic
1185381221 22:50508214-50508236 CCCAGGAAAATGCGTAGGCGCGG - Intronic
949680769 3:6512103-6512125 CACAAAAATGTGCTTAGGCTGGG + Intergenic
951799281 3:26577110-26577132 CACAGGACTCTGCCTAGGCCAGG - Intergenic
952182708 3:30935265-30935287 TAATGGAAAGTGCCTGGGCTAGG - Intergenic
953927454 3:46989630-46989652 GACAGGAAGGGGCCTAGGTTTGG - Intronic
954715406 3:52524344-52524366 CACAGTCAAGTGACGAGGCTGGG + Exonic
955242052 3:57186927-57186949 TACAGGCAAGTTCCTATGCTAGG + Intergenic
960628644 3:119705483-119705505 AACAGCAAAGTCCCTAGGATGGG - Intronic
963047954 3:141117177-141117199 CAAAGGACAGGGCCTATGCTGGG + Intronic
966220679 3:177548159-177548181 CACCGGAAAGAGTCAAGGCTCGG + Intergenic
967400667 3:189056658-189056680 CCCATGAAAGTGCCTAGTATAGG + Intronic
969666665 4:8561262-8561284 CACAGGAAAGTGCCTAGGCTGGG + Intronic
969796622 4:9532458-9532480 CACAGGCAAGCCCCGAGGCTGGG + Intergenic
972215287 4:36891068-36891090 CACTGGAAAGTGCCCCGGTTGGG + Intergenic
974623079 4:64385503-64385525 CACAGGATACTGCATAGGCTGGG + Intronic
975504755 4:75125510-75125532 CCAAGGAAAGTGGCAAGGCTTGG + Intergenic
976177683 4:82371970-82371992 GACAAGAATCTGCCTAGGCTGGG + Intronic
976393139 4:84526254-84526276 CACAGGAAGGGGTCTGGGCTGGG + Intergenic
979139391 4:117153044-117153066 CCCAGAAGAGTGCCTAGGCATGG + Intergenic
985610372 5:884669-884691 CCCAGGCAAGTGCCCAGGGTGGG - Intronic
986052019 5:4099004-4099026 CAAGACAAAGTGCCTAGGCTGGG + Intergenic
987681517 5:21142974-21142996 CTCAGGATAACGCCTAGGCTGGG + Intergenic
991477291 5:67036003-67036025 CTCAGGAAAGAGCCTGGGTTGGG + Intronic
992355270 5:75975487-75975509 CACAGGAAAGTGTCAAGAATAGG - Intergenic
992683036 5:79171968-79171990 CATAGGAATGTGCATAGGCCTGG + Intronic
993703176 5:91142555-91142577 AACAGGAAAGTGATTAAGCTGGG - Intronic
994215715 5:97134935-97134957 CAAAGGAAAGTCCCTCTGCTGGG - Intronic
997413940 5:133710685-133710707 CACAGCCAAGTGCCTAGGCCAGG - Intergenic
997841563 5:137245586-137245608 CAGATGAAAGTGCCCAGGCATGG + Intronic
999378551 5:151104062-151104084 CACAGAAAAGTGGCTAGGTGAGG + Intronic
999443432 5:151620377-151620399 CACAGGAAGGGGCCTCGACTAGG + Intergenic
1001244556 5:170096171-170096193 CTCTGGAAAATGCCTCGGCTGGG - Intergenic
1002364118 5:178696876-178696898 GAGAGGAAACTGCCTGGGCTGGG + Intergenic
1003079897 6:3013596-3013618 TACAGGAAGGTGGCTGGGCTGGG - Intronic
1003111099 6:3252860-3252882 CACAGGAAAGACCTTAGGCAAGG + Intronic
1007686912 6:43672427-43672449 TACAGGAACCTTCCTAGGCTAGG - Exonic
1007810270 6:44480677-44480699 CACAGGAAATTGGCTAGCCATGG - Intergenic
1009572365 6:65403084-65403106 CATCGGAAAGTGTCTAGACTTGG - Intronic
1013692557 6:112663140-112663162 CTCAGGAAAGTGCCAGGGCCAGG + Intergenic
1017130942 6:151107791-151107813 CACAGGAAAGCACCTAAGTTAGG - Intergenic
1018812466 6:167307918-167307940 CAGAGGAAGGGGCCTGGGCTGGG - Intronic
1019397693 7:830996-831018 CACAGGACAGGGCCTTGGCCTGG - Intronic
1019493068 7:1324029-1324051 CACAGGAAGGTGCTTAGCCCAGG - Intergenic
1022010694 7:26305635-26305657 CACAGGAAACTTCCTATGTTGGG + Intronic
1022456231 7:30560550-30560572 CAAATGAAAGTGTTTAGGCTGGG - Intergenic
1022809787 7:33857566-33857588 CTCAGGAGAGTGCCTGGACTTGG - Intergenic
1023703212 7:42912400-42912422 CAGTGGAAAGTGCTTTGGCTTGG - Intronic
1026012924 7:66650971-66650993 CACAGGGACATGCCGAGGCTCGG - Intronic
1026391223 7:69904201-69904223 AACAGGAAAGAGCATGGGCTGGG - Intronic
1029688732 7:102166318-102166340 CCCAGGACAGTGCTCAGGCTTGG + Intronic
1034067522 7:148151251-148151273 CTCAGGAGAGTGCCTCGCCTAGG + Intronic
1034673761 7:152876792-152876814 CACAGGCATGTGCCTGGGCCGGG + Intergenic
1035300612 7:157894900-157894922 GACAGGAAAGTGGATCGGCTGGG + Intronic
1035744734 8:1953567-1953589 CCCAGGAAACAGCCTAAGCTAGG + Intronic
1036921512 8:12859740-12859762 CATAGCAAAGTGCCCAGACTAGG - Intergenic
1037899770 8:22681025-22681047 GGCATGAAACTGCCTAGGCTAGG + Intergenic
1039331549 8:36543075-36543097 CTCAGGGAAGGGCCTAAGCTGGG - Intergenic
1040671261 8:49693677-49693699 CACAGAAAACTACCTAGTCTTGG - Intergenic
1041200789 8:55450942-55450964 CGCAGGAAGGAGACTAGGCTGGG + Intronic
1041725826 8:61016521-61016543 CAGAGTAAAGTCCCTAGGTTTGG - Intergenic
1041789555 8:61677925-61677947 CACAGGAAGGTTGCTTGGCTGGG - Intronic
1042184761 8:66125595-66125617 CACAATTAACTGCCTAGGCTGGG + Intergenic
1042334301 8:67614215-67614237 GACAGGCAAGTGCAGAGGCTGGG - Intronic
1042500572 8:69504238-69504260 TACAAGTAAGTGTCTAGGCTGGG + Intronic
1043743309 8:83842053-83842075 GACAGGGAAGGCCCTAGGCTGGG - Intergenic
1043765184 8:84121882-84121904 CAAATGAAGGTGCCTAGGCTAGG + Intergenic
1044569536 8:93701013-93701035 CACAGGAAAAGGCCCAGGCCGGG - Intronic
1047020154 8:120767115-120767137 CACAAGGTAGTGACTAGGCTTGG - Intronic
1047409480 8:124612354-124612376 CACAGGAAACGGCATAGGCAGGG + Intronic
1047498244 8:125423698-125423720 AACAGGAAAGTGTCTAGAATTGG + Intergenic
1048825179 8:138417293-138417315 CACTGGCAGGTGCCTGGGCTGGG - Intronic
1049379597 8:142305386-142305408 CCCAGGAAAGCGGCCAGGCTGGG + Intronic
1051819625 9:21149585-21149607 CACTGGCAAGTGCCTCGGCTTGG + Intergenic
1056893931 9:90523299-90523321 CAGAGGAAAGAGGCTGGGCTTGG - Intergenic
1057201337 9:93142014-93142036 GACAGGAAAGGGCTTTGGCTTGG - Intergenic
1059466545 9:114472280-114472302 CAGAGGAAAGTCCCCAGACTCGG + Intronic
1060180618 9:121531097-121531119 TACATGAAACTCCCTAGGCTGGG - Intergenic
1060268288 9:122124918-122124940 AACAGGAGAGTGGCTGGGCTGGG + Intergenic
1060679338 9:125547344-125547366 GAGAGGAAAGGGCATAGGCTGGG + Intronic
1060959699 9:127671325-127671347 CACAGGCATCTGCCTAGTCTGGG - Intronic
1062466103 9:136682331-136682353 CACAGGACAGGGACTGGGCTGGG - Intronic
1062519979 9:136953744-136953766 CACAGTGAACTGCCCAGGCTGGG - Exonic
1186124968 X:6403233-6403255 CACAGGAGAGTGACAAGGGTTGG + Intergenic
1187667403 X:21628588-21628610 CACAGGAAGCTGCCAAGGCTTGG + Intronic
1188102251 X:26103504-26103526 CACTGAAAGGTGCCTGGGCTTGG - Intergenic
1192181424 X:68918104-68918126 CAGAGGAAAGAGGCTTGGCTAGG + Intergenic
1194018515 X:88657381-88657403 CACTGGCAAGTGCCTAGGCTGGG - Intergenic
1196104351 X:111880461-111880483 CACAGGACAGTGCCCAGACAGGG - Intronic