ID: 969669398

View in Genome Browser
Species Human (GRCh38)
Location 4:8581463-8581485
Sequence CGCGGACGCTCAGGCTCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669398_969669405 13 Left 969669398 4:8581463-8581485 CCGCCCGAGCCTGAGCGTCCGCG 0: 1
1: 0
2: 2
3: 1
4: 83
Right 969669405 4:8581499-8581521 ACCGCCACGCTCCATGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 36
969669398_969669410 30 Left 969669398 4:8581463-8581485 CCGCCCGAGCCTGAGCGTCCGCG 0: 1
1: 0
2: 2
3: 1
4: 83
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669398_969669404 12 Left 969669398 4:8581463-8581485 CCGCCCGAGCCTGAGCGTCCGCG 0: 1
1: 0
2: 2
3: 1
4: 83
Right 969669404 4:8581498-8581520 CACCGCCACGCTCCATGCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669398 Original CRISPR CGCGGACGCTCAGGCTCGGG CGG (reversed) Exonic