ID: 969669399

View in Genome Browser
Species Human (GRCh38)
Location 4:8581466-8581488
Sequence AAGCGCGGACGCTCAGGCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669399_969669410 27 Left 969669399 4:8581466-8581488 CCCGAGCCTGAGCGTCCGCGCTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669399_969669405 10 Left 969669399 4:8581466-8581488 CCCGAGCCTGAGCGTCCGCGCTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 969669405 4:8581499-8581521 ACCGCCACGCTCCATGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 36
969669399_969669411 30 Left 969669399 4:8581466-8581488 CCCGAGCCTGAGCGTCCGCGCTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 969669411 4:8581519-8581541 GGGCTTCGTGCTGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 184
969669399_969669404 9 Left 969669399 4:8581466-8581488 CCCGAGCCTGAGCGTCCGCGCTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 969669404 4:8581498-8581520 CACCGCCACGCTCCATGCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669399 Original CRISPR AAGCGCGGACGCTCAGGCTC GGG (reversed) Exonic