ID: 969669401

View in Genome Browser
Species Human (GRCh38)
Location 4:8581472-8581494
Sequence GCTGCGAAGCGCGGACGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669401_969669405 4 Left 969669401 4:8581472-8581494 CCTGAGCGTCCGCGCTTCGCAGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 969669405 4:8581499-8581521 ACCGCCACGCTCCATGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 36
969669401_969669410 21 Left 969669401 4:8581472-8581494 CCTGAGCGTCCGCGCTTCGCAGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669401_969669411 24 Left 969669401 4:8581472-8581494 CCTGAGCGTCCGCGCTTCGCAGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 969669411 4:8581519-8581541 GGGCTTCGTGCTGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 184
969669401_969669404 3 Left 969669401 4:8581472-8581494 CCTGAGCGTCCGCGCTTCGCAGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 969669404 4:8581498-8581520 CACCGCCACGCTCCATGCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669401 Original CRISPR GCTGCGAAGCGCGGACGCTC AGG (reversed) Exonic