ID: 969669402

View in Genome Browser
Species Human (GRCh38)
Location 4:8581481-8581503
Sequence GCGGTGAAGGCTGCGAAGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669402_969669405 -5 Left 969669402 4:8581481-8581503 CCGCGCTTCGCAGCCTTCACCGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 969669405 4:8581499-8581521 ACCGCCACGCTCCATGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 36
969669402_969669410 12 Left 969669402 4:8581481-8581503 CCGCGCTTCGCAGCCTTCACCGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669402_969669404 -6 Left 969669402 4:8581481-8581503 CCGCGCTTCGCAGCCTTCACCGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 969669404 4:8581498-8581520 CACCGCCACGCTCCATGCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 72
969669402_969669411 15 Left 969669402 4:8581481-8581503 CCGCGCTTCGCAGCCTTCACCGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 969669411 4:8581519-8581541 GGGCTTCGTGCTGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669402 Original CRISPR GCGGTGAAGGCTGCGAAGCG CGG (reversed) Exonic