ID: 969669403

View in Genome Browser
Species Human (GRCh38)
Location 4:8581494-8581516
Sequence GGCATGGAGCGTGGCGGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669403_969669411 2 Left 969669403 4:8581494-8581516 CCTTCACCGCCACGCTCCATGCC 0: 1
1: 1
2: 2
3: 26
4: 222
Right 969669411 4:8581519-8581541 GGGCTTCGTGCTGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 184
969669403_969669413 26 Left 969669403 4:8581494-8581516 CCTTCACCGCCACGCTCCATGCC 0: 1
1: 1
2: 2
3: 26
4: 222
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669403_969669410 -1 Left 969669403 4:8581494-8581516 CCTTCACCGCCACGCTCCATGCC 0: 1
1: 1
2: 2
3: 26
4: 222
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669403 Original CRISPR GGCATGGAGCGTGGCGGTGA AGG (reversed) Exonic