ID: 969669406

View in Genome Browser
Species Human (GRCh38)
Location 4:8581500-8581522
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669406_969669413 20 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669406_969669415 28 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669406_969669416 29 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669416 4:8581552-8581574 CACCTCGCTCCAGGTGCACCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
969669406_969669411 -4 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669411 4:8581519-8581541 GGGCTTCGTGCTGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 184
969669406_969669410 -7 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669406 Original CRISPR GCCCACGGCATGGAGCGTGG CGG (reversed) Exonic