ID: 969669407

View in Genome Browser
Species Human (GRCh38)
Location 4:8581503-8581525
Sequence GAAGCCCACGGCATGGAGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669407_969669411 -7 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669411 4:8581519-8581541 GGGCTTCGTGCTGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 184
969669407_969669418 29 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
969669407_969669415 25 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669407_969669410 -10 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669407_969669416 26 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669416 4:8581552-8581574 CACCTCGCTCCAGGTGCACCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
969669407_969669413 17 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669407 Original CRISPR GAAGCCCACGGCATGGAGCG TGG (reversed) Exonic