ID: 969669408

View in Genome Browser
Species Human (GRCh38)
Location 4:8581510-8581532
Sequence GCAGCACGAAGCCCACGGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669408_969669413 10 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669408_969669416 19 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669416 4:8581552-8581574 CACCTCGCTCCAGGTGCACCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
969669408_969669415 18 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669408_969669418 22 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669408 Original CRISPR GCAGCACGAAGCCCACGGCA TGG (reversed) Exonic