ID: 969669410

View in Genome Browser
Species Human (GRCh38)
Location 4:8581516-8581538
Sequence CGTGGGCTTCGTGCTGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669398_969669410 30 Left 969669398 4:8581463-8581485 CCGCCCGAGCCTGAGCGTCCGCG 0: 1
1: 0
2: 2
3: 1
4: 83
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669407_969669410 -10 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669399_969669410 27 Left 969669399 4:8581466-8581488 CCCGAGCCTGAGCGTCCGCGCTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669406_969669410 -7 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669402_969669410 12 Left 969669402 4:8581481-8581503 CCGCGCTTCGCAGCCTTCACCGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669400_969669410 26 Left 969669400 4:8581467-8581489 CCGAGCCTGAGCGTCCGCGCTTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669401_969669410 21 Left 969669401 4:8581472-8581494 CCTGAGCGTCCGCGCTTCGCAGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106
969669403_969669410 -1 Left 969669403 4:8581494-8581516 CCTTCACCGCCACGCTCCATGCC 0: 1
1: 1
2: 2
3: 26
4: 222
Right 969669410 4:8581516-8581538 CGTGGGCTTCGTGCTGCCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669410 Original CRISPR CGTGGGCTTCGTGCTGCCGC TGG Exonic