ID: 969669412

View in Genome Browser
Species Human (GRCh38)
Location 4:8581532-8581554
Sequence GTGAGGCAGAGCACCGCCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669412_969669415 -4 Left 969669412 4:8581532-8581554 CCGCTGGCGGTGCTCTGCCTCAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669412_969669421 24 Left 969669412 4:8581532-8581554 CCGCTGGCGGTGCTCTGCCTCAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 969669421 4:8581579-8581601 ACGCAGACACTGCCAGCGCATGG 0: 1
1: 0
2: 0
3: 10
4: 104
969669412_969669416 -3 Left 969669412 4:8581532-8581554 CCGCTGGCGGTGCTCTGCCTCAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 969669416 4:8581552-8581574 CACCTCGCTCCAGGTGCACCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
969669412_969669418 0 Left 969669412 4:8581532-8581554 CCGCTGGCGGTGCTCTGCCTCAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669412 Original CRISPR GTGAGGCAGAGCACCGCCAG CGG (reversed) Exonic