ID: 969669413

View in Genome Browser
Species Human (GRCh38)
Location 4:8581543-8581565
Sequence GCTCTGCCTCACCTCGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669406_969669413 20 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669403_969669413 26 Left 969669403 4:8581494-8581516 CCTTCACCGCCACGCTCCATGCC 0: 1
1: 1
2: 2
3: 26
4: 222
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669409_969669413 5 Left 969669409 4:8581515-8581537 CCGTGGGCTTCGTGCTGCCGCTG 0: 1
1: 1
2: 0
3: 11
4: 173
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669407_969669413 17 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247
969669408_969669413 10 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669413 4:8581543-8581565 GCTCTGCCTCACCTCGCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669413 Original CRISPR GCTCTGCCTCACCTCGCTCC AGG Exonic