ID: 969669415

View in Genome Browser
Species Human (GRCh38)
Location 4:8581551-8581573
Sequence TCACCTCGCTCCAGGTGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669408_969669415 18 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669406_969669415 28 Left 969669406 4:8581500-8581522 CCGCCACGCTCCATGCCGTGGGC 0: 1
1: 0
2: 1
3: 14
4: 115
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669412_969669415 -4 Left 969669412 4:8581532-8581554 CCGCTGGCGGTGCTCTGCCTCAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669407_969669415 25 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194
969669409_969669415 13 Left 969669409 4:8581515-8581537 CCGTGGGCTTCGTGCTGCCGCTG 0: 1
1: 1
2: 0
3: 11
4: 173
Right 969669415 4:8581551-8581573 TCACCTCGCTCCAGGTGCACCGG 0: 1
1: 0
2: 1
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669415 Original CRISPR TCACCTCGCTCCAGGTGCAC CGG Exonic