ID: 969669418

View in Genome Browser
Species Human (GRCh38)
Location 4:8581555-8581577
Sequence CTCGCTCCAGGTGCACCGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969669408_969669418 22 Left 969669408 4:8581510-8581532 CCATGCCGTGGGCTTCGTGCTGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
969669412_969669418 0 Left 969669412 4:8581532-8581554 CCGCTGGCGGTGCTCTGCCTCAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
969669407_969669418 29 Left 969669407 4:8581503-8581525 CCACGCTCCATGCCGTGGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
969669409_969669418 17 Left 969669409 4:8581515-8581537 CCGTGGGCTTCGTGCTGCCGCTG 0: 1
1: 1
2: 0
3: 11
4: 173
Right 969669418 4:8581555-8581577 CTCGCTCCAGGTGCACCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969669418 Original CRISPR CTCGCTCCAGGTGCACCGGG TGG Exonic