ID: 969670465

View in Genome Browser
Species Human (GRCh38)
Location 4:8587367-8587389
Sequence TGGGGGCGATGAGCCCTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969670465_969670472 2 Left 969670465 4:8587367-8587389 CCTGGCAGGGCTCATCGCCCCCA 0: 1
1: 1
2: 1
3: 20
4: 180
Right 969670472 4:8587392-8587414 TTCTAAGAAGCCCTGTGGAAAGG 0: 1
1: 0
2: 1
3: 27
4: 220
969670465_969670473 3 Left 969670465 4:8587367-8587389 CCTGGCAGGGCTCATCGCCCCCA 0: 1
1: 1
2: 1
3: 20
4: 180
Right 969670473 4:8587393-8587415 TCTAAGAAGCCCTGTGGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 226
969670465_969670474 9 Left 969670465 4:8587367-8587389 CCTGGCAGGGCTCATCGCCCCCA 0: 1
1: 1
2: 1
3: 20
4: 180
Right 969670474 4:8587399-8587421 AAGCCCTGTGGAAAGGGCACTGG 0: 1
1: 0
2: 3
3: 33
4: 280
969670465_969670470 -3 Left 969670465 4:8587367-8587389 CCTGGCAGGGCTCATCGCCCCCA 0: 1
1: 1
2: 1
3: 20
4: 180
Right 969670470 4:8587387-8587409 CCACCTTCTAAGAAGCCCTGTGG 0: 1
1: 0
2: 1
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969670465 Original CRISPR TGGGGGCGATGAGCCCTGCC AGG (reversed) Exonic
900637000 1:3670969-3670991 TGGGAGGGAGGAGCCCTGGCAGG + Intronic
901456161 1:9364086-9364108 TGTGGCCCAAGAGCCCTGCCAGG - Intronic
902513622 1:16978890-16978912 TGGGAGCTGGGAGCCCTGCCCGG - Intronic
904605621 1:31696212-31696234 TGGGGCCCATGCCCCCTGCCTGG - Intronic
906155819 1:43613360-43613382 TGGGGGCACTAGGCCCTGCCTGG - Intronic
906208107 1:43997661-43997683 TGGGGGCGTAGCGCCCTGTCCGG + Exonic
906481911 1:46204591-46204613 TGGGGGCTCTGAGACCAGCCAGG + Intronic
915292557 1:154896461-154896483 TGGGGCCGGTCACCCCTGCCTGG - Intergenic
917846678 1:179025985-179026007 TGGGGGCGGTGAGCGCGGCGTGG + Exonic
919809518 1:201399709-201399731 TGGGGGCGGGGACCCCTGCCGGG + Intergenic
922184467 1:223261905-223261927 TGGGGGTGATGAGTCCTACTTGG - Intronic
924542143 1:244991247-244991269 AGGGTGCGGTGAGCTCTGCCAGG + Intronic
1064769643 10:18710633-18710655 CGGGGACGCTGACCCCTGCCCGG + Intergenic
1065046785 10:21752792-21752814 TGGGGGCGAGAATCCCAGCCCGG - Intergenic
1066351673 10:34642148-34642170 TGGGGGCCATGAGCCTTGGGTGG - Intronic
1066357919 10:34702657-34702679 TTGGGGGGATAAGCCCTGGCTGG - Intronic
1067084732 10:43231761-43231783 TGCTGGGGCTGAGCCCTGCCAGG + Intronic
1067306762 10:45071599-45071621 TGGGGGCGCTGTGCCTCGCCCGG - Intergenic
1071553583 10:86585662-86585684 TGGGGCAGAAGAGCCCTCCCCGG - Intergenic
1072924812 10:99607693-99607715 TGGGGCTGGTCAGCCCTGCCAGG - Intergenic
1075919473 10:126198384-126198406 TGTGGGTGATGAGACTTGCCGGG - Intronic
1077055656 11:591608-591630 TTGTGGCCATGAGCCCTGTCTGG + Intronic
1078534120 11:12159924-12159946 AGGGGGCTCTGTGCCCTGCCTGG - Intronic
1080622333 11:33997078-33997100 TAGGGCCGAAGAGCCCTGACAGG - Intergenic
1080694199 11:34586713-34586735 TGGGGGAGATGTGCCCTAGCTGG + Intergenic
1082793914 11:57366414-57366436 TGGGTGCCATGAACCATGCCGGG - Intronic
1082808424 11:57464129-57464151 TGGGGGAGGTGAGCCCTGGTTGG + Intronic
1083419547 11:62545459-62545481 GGGGGGCGACCAGCCCTGCCAGG + Intronic
1083962189 11:66020739-66020761 TGGGGTCACTGAGCCCTGGCCGG + Intronic
1084204480 11:67583927-67583949 GGTGGGCGAGGAGCCCTGCCGGG - Intronic
1087262694 11:96028391-96028413 TGGGGTCGAGGAGGCCTCCCAGG - Intronic
1089579383 11:119471811-119471833 TGGGTGCCCTGAGTCCTGCCGGG - Intergenic
1089732981 11:120531012-120531034 TGGGGGTGATGAGTCCTTCCTGG + Intronic
1091670892 12:2451581-2451603 TGGGAGGGAGGGGCCCTGCCTGG + Intronic
1091807269 12:3365730-3365752 TGGGGGCCGTGTGCCCTCCCGGG - Intergenic
1096499261 12:52055319-52055341 AGGGTGGGATCAGCCCTGCCAGG + Intronic
1096789668 12:54036963-54036985 TGGGGCTGGTGTGCCCTGCCTGG - Intronic
1098146576 12:67503796-67503818 AGGGAGCGGTGAGCCCTGGCGGG + Intergenic
1099964360 12:89429680-89429702 TGGGGGATTTGGGCCCTGCCTGG - Intronic
1104307332 12:127621548-127621570 TGGGGGTGATATGCCCTGTCTGG - Intergenic
1105339250 13:19504458-19504480 TGGGTGTGAGGAACCCTGCCAGG + Intronic
1105583232 13:21720619-21720641 TGGGGGCCATGAGCCTAGGCGGG - Intergenic
1105935705 13:25096294-25096316 TGGAGAGGATGGGCCCTGCCGGG - Exonic
1106773478 13:32985430-32985452 AGTGGGCGAGGAGCTCTGCCTGG + Intergenic
1107434872 13:40373333-40373355 TGGGGGTGCTGGACCCTGCCTGG + Intergenic
1112580654 13:100674439-100674461 TGGGGGCGGCGACCTCTGCCCGG + Intronic
1113601699 13:111573969-111573991 CGGAGACAATGAGCCCTGCCAGG + Intergenic
1113978049 13:114246646-114246668 TGGGGGAGATGAGCAGTGCAGGG + Intronic
1119401226 14:74364011-74364033 TGGGGGGGATGAGCCCAGATTGG - Intergenic
1119705663 14:76781246-76781268 TGGGGTCAATGAGCCCTGGGAGG + Exonic
1121343031 14:93116164-93116186 TGGGGGTGCTGAACCCTGCTGGG - Intronic
1122119393 14:99543885-99543907 TGTGGGCACTGAGGCCTGCCTGG - Intronic
1122899258 14:104775441-104775463 TGGGGTTGCTGAGCCCTGCCAGG - Intronic
1124641807 15:31400593-31400615 TGGGGGTGAGGTGCCCTGCAGGG + Intronic
1125329048 15:38564670-38564692 CGGGGGCGATGCGCCGCGCCCGG - Exonic
1126201841 15:45995385-45995407 TGGGGGCGGTGAGCACTCCCAGG + Intergenic
1127849613 15:62901370-62901392 TGGGGGCGATGCTCCCGGCTTGG + Intergenic
1129697033 15:77746615-77746637 TGGGGGCGAGGAGCCCTGCCTGG + Intronic
1131060258 15:89400056-89400078 GGGGGGCGCTGAGCCTTACCCGG + Intergenic
1131131562 15:89903777-89903799 TCGGGGCGATGGTCCCTTCCTGG - Exonic
1132403127 15:101526148-101526170 TGGGGGAGAGGAGCGCAGCCAGG - Intergenic
1133087767 16:3378426-3378448 TGGGGGCTAGGAGTCCAGCCAGG - Intronic
1134684596 16:16149908-16149930 AGGGCGAGATGGGCCCTGCCCGG + Exonic
1134807716 16:17139881-17139903 TGGGGGCAGTCAGCCCTCCCCGG + Intronic
1136704211 16:32172741-32172763 AGGGTGCCATGAGCCCTGGCAGG - Intergenic
1136763698 16:32756665-32756687 AGGGTGCCATGAGCCCTGGCAGG + Intergenic
1136804401 16:33113721-33113743 AGGGTGCCATGAGCCCTGGCAGG - Intergenic
1137676603 16:50306669-50306691 TTGGGGCCATGAGCTCTGCAGGG + Intronic
1142379401 16:89722934-89722956 TGGGGGGAATGGGCCATGCCCGG + Intronic
1203065848 16_KI270728v1_random:1016986-1017008 AGGGTGCCATGAGCCCTGGCAGG + Intergenic
1144938627 17:18920134-18920156 TTGGTGAGATGAGCCATGCCCGG + Intronic
1145388398 17:22435565-22435587 TGGGGGCGTTGAGCCAGCCCGGG - Intergenic
1147046006 17:37752652-37752674 TGGGGGTGAAGAGCCATGCAGGG + Intergenic
1147587871 17:41663007-41663029 TGGAGGCGTCAAGCCCTGCCTGG - Intergenic
1149549149 17:57527247-57527269 GGTGGGGGATGAGTCCTGCCAGG - Intronic
1151576030 17:74953074-74953096 TGGGGGCCAGGAGCCCAGCCAGG - Exonic
1152537562 17:80959543-80959565 CGGGGGCGATGGCACCTGCCAGG - Intronic
1152567005 17:81104905-81104927 TTGGGGCGAAGACCCCTGCCAGG - Intronic
1152570342 17:81118912-81118934 TGGCAGAGATGAGCCCAGCCTGG + Intronic
1152642219 17:81454014-81454036 TGGAGACAAAGAGCCCTGCCTGG - Intronic
1152774736 17:82193981-82194003 TGGAGGCCATGAGCCGCGCCCGG - Exonic
1154299055 18:13176753-13176775 TGGGGCCTAGGAGCCCTGTCAGG - Intergenic
1157699417 18:49751531-49751553 TGGGGCTGCTGAGCCCTACCGGG - Intergenic
1160105448 18:75970384-75970406 TGGGGGCTACCTGCCCTGCCGGG - Intergenic
1160243294 18:77137811-77137833 GGTGGCCCATGAGCCCTGCCCGG + Intergenic
1160554610 18:79717354-79717376 TGAGGGCCCTGAGCCCTGCAGGG + Intronic
1160740019 19:681263-681285 TTGGGGCCAAGAGCCCTGCGGGG + Intronic
1161153274 19:2720591-2720613 TGGGGTAGATTGGCCCTGCCTGG - Intronic
1161153685 19:2721656-2721678 TGGGGGCCAGGAGCCCGGCTTGG + Intronic
1161455147 19:4366216-4366238 TGGGGGAGAGGCTCCCTGCCAGG + Intronic
1163029512 19:14535074-14535096 TGAGAGTGATGAGCCTTGCCTGG + Intronic
1163667649 19:18610778-18610800 GGGGGGCGCTGAGGCCGGCCTGG - Intronic
1165061747 19:33208174-33208196 TGGGGGCTTTGAGGCCTGCAGGG - Exonic
1165080241 19:33302565-33302587 AGGGGGCGACGCGGCCTGCCGGG - Intergenic
1165323154 19:35098760-35098782 TGGTGGCGCTGAGCCCTGCCAGG + Intergenic
1165840833 19:38788456-38788478 TTGGGGCAATGGGTCCTGCCCGG + Intergenic
1166252079 19:41578077-41578099 TCTGGGGGCTGAGCCCTGCCTGG - Intronic
1166288726 19:41848367-41848389 TGGGGGAGATGAGAACTGTCTGG + Intronic
1167486972 19:49768196-49768218 TGGGGACGGTGGTCCCTGCCAGG + Intronic
925008538 2:465107-465129 TGGGGGCTCTGAGACCTGCTGGG - Intergenic
925997856 2:9306641-9306663 TCGGGTTGATGAGCCCAGCCAGG + Intronic
926196600 2:10767864-10767886 TGGGGGCGATGATCACAGCTCGG - Intronic
926269893 2:11357458-11357480 TGGGAGCCATGGGCCCTGTCGGG - Intergenic
928886835 2:36158911-36158933 TGGGTGAGATGAGATCTGCCAGG + Intergenic
929670928 2:43876025-43876047 AGGAGGCAATGAGCCCTGCCTGG - Intronic
933847302 2:86336751-86336773 TGGTGGCGATGACACCTCCCAGG - Intronic
934559235 2:95303736-95303758 TGGGGCGGCTGTGCCCTGCCAGG + Intronic
935205799 2:100895685-100895707 TGGGGGTAAGGAGCTCTGCCAGG - Intronic
937309434 2:120893028-120893050 TGTGGGCCATGACCCCTGCCTGG + Intronic
937861952 2:126718386-126718408 TGGGGCCAGTGAGCCCTTCCAGG + Intergenic
939570031 2:143830310-143830332 TGGGGGCTCTGAACCCTGTCTGG - Intergenic
940396369 2:153196517-153196539 TGGGGGCAAAGGGCCCTTCCTGG + Intergenic
946277938 2:218644644-218644666 TGGGGGTGTTGGGCCCTGCATGG + Exonic
946393455 2:219430540-219430562 TGGGGGCCATCAGCCCTTCCTGG - Intergenic
946404205 2:219483994-219484016 TGGGGGCGCTGGGCCGTGCAGGG - Exonic
948191551 2:236063001-236063023 TGGAGGCCAGGATCCCTGCCTGG - Intronic
1168750729 20:279355-279377 AGGCGGCGCTGCGCCCTGCCCGG + Intronic
1169379722 20:5096074-5096096 TCAGGGAGAGGAGCCCTGCCTGG + Intronic
1170787055 20:19476772-19476794 TTTGGGAGAGGAGCCCTGCCTGG - Intronic
1174179491 20:48665997-48666019 TGGGGGGGATGTGGCCTTCCAGG - Intronic
1175909460 20:62397844-62397866 TGGGGGCCAACAGCCCTGCAGGG - Intronic
1176734892 21:10536956-10536978 TGGGTGTGAGGAACCCTGCCAGG - Intronic
1178900528 21:36594467-36594489 TGGGGGCCAAGAGCCTTGCCTGG + Intergenic
1179511875 21:41878953-41878975 CGGGGGCGCGGAGCCCGGCCAGG + Intronic
1179525793 21:41974990-41975012 AGGGGGCGATGGGCTCTGCCTGG + Intergenic
1180562626 22:16632418-16632440 TGGGTGTGAGGAACCCTGCCAGG - Intergenic
1180733662 22:18000740-18000762 TGGGGGCGGTGGGCGCGGCCGGG - Intronic
1182677058 22:32047556-32047578 TTGGGAGGAAGAGCCCTGCCAGG + Intronic
1183110761 22:35646910-35646932 TGGGGCCGCTGAGCCATCCCAGG - Intergenic
1183587756 22:38762770-38762792 TGGGGCTGATGAGCCATGCACGG - Intronic
1184659139 22:45957883-45957905 TGGGGCAGAGGAGCCCTGGCAGG - Intronic
1184870067 22:47232234-47232256 TAGGGGAGAAGAGCCCTGGCTGG - Intergenic
950589633 3:13927441-13927463 GGGGGGCCGTGAGCCCTGCAAGG - Intergenic
950606825 3:14089244-14089266 AGGGGGCCATGAGCCCTGCAAGG + Intergenic
950615036 3:14151482-14151504 AGTGGGCGATGCCCCCTGCCTGG - Intronic
951507547 3:23465302-23465324 TGGGGGCCAGGAGAGCTGCCTGG - Intronic
953544834 3:43856810-43856832 TGGGGGAGACGAGTCCAGCCAGG - Intergenic
955801670 3:62693197-62693219 TGGGGGTGATGAGCACTTCTGGG - Intronic
956212706 3:66818125-66818147 TGTGGGCACTGAGCCCAGCCGGG - Intergenic
958623900 3:96600638-96600660 TGGGTGTGAAGAACCCTGCCAGG + Intergenic
961649416 3:128410037-128410059 TGGGGGCTGTGAGCCCAGCTCGG - Intergenic
961659383 3:128460425-128460447 TGGGGTCAATGACCCCTGTCTGG + Intergenic
962756733 3:138470571-138470593 TTAGGGCCCTGAGCCCTGCCTGG + Intronic
966538846 3:181066340-181066362 TGGGGTGGATGAGTCCTGCAGGG - Intergenic
966899126 3:184467705-184467727 GGGGGCCGAAGAGCCCTTCCTGG + Intronic
968350251 3:198047241-198047263 GGGGGGTGATGAGCGCTGCTGGG - Intergenic
968510377 4:992977-992999 TTGGGGCAGTGAGCCCAGCCTGG + Intronic
968516069 4:1016150-1016172 TGGGGGCCAAGAGCCCTGGCAGG + Intronic
968735239 4:2291784-2291806 TGGAGGACATGAACCCTGCCTGG + Intronic
969388676 4:6874420-6874442 TGGTGGGGATGAGGCCAGCCAGG + Intronic
969670465 4:8587367-8587389 TGGGGGCGATGAGCCCTGCCAGG - Exonic
978764465 4:112390130-112390152 TGAGGCCCATGGGCCCTGCCAGG + Intronic
985543601 5:498346-498368 TGGCGGGGAAGAGCCCAGCCCGG - Intronic
985651973 5:1111665-1111687 AGGGGGCGAGGGGCCCTGCCAGG - Intronic
985658493 5:1144061-1144083 AGGGGGCGAACAGCCCTGCAGGG + Intergenic
986814696 5:11395912-11395934 TTGGGGCCATGTGGCCTGCCAGG + Intronic
997657889 5:135568804-135568826 TGGGAGCCCTGAACCCTGCCTGG - Intergenic
998424088 5:142012595-142012617 GTGGGGCAATGAGCTCTGCCTGG + Exonic
999437629 5:151575844-151575866 TGGGAGCCATGAGCCATGCATGG + Intergenic
999664263 5:153896284-153896306 AGGGCTAGATGAGCCCTGCCTGG + Intergenic
1002076504 5:176711818-176711840 GGGGGGCGCAGAGCCCTGCCGGG - Intergenic
1002193228 5:177489613-177489635 TGGGGGCGGTAGGGCCTGCCGGG + Exonic
1002416342 5:179122791-179122813 TGTGGGAGGTGAACCCTGCCTGG - Intronic
1002461478 5:179375972-179375994 TGGGGAGGAGGAGCCCAGCCAGG + Intergenic
1003153478 6:3571987-3572009 TGGGGGAAATGAGCCTTGCTCGG + Intergenic
1004128680 6:12898652-12898674 TGGAAGCAATGAGTCCTGCCAGG - Intronic
1006131446 6:31871589-31871611 TGGGGGCCAGGAGCTCTGCCTGG + Intronic
1007299433 6:40855734-40855756 CGGGGGCGAGGAGCCCAGGCAGG + Intergenic
1007628967 6:43262280-43262302 TGGGGGTGATGAAACCAGCCAGG + Intronic
1011517172 6:88166731-88166753 TGTTGGCGATGCGCGCTGCCCGG - Intergenic
1019148546 6:169988977-169988999 TGGGCGGGATGAGCCCTGTGGGG + Intergenic
1019154050 6:170026897-170026919 TGCAGGCGAAGAGCCCGGCCTGG - Intergenic
1019262362 7:88639-88661 TGGAGGCCATGAGGCCGGCCCGG - Intergenic
1019515449 7:1438012-1438034 TGGGGGCCATGAACTCTGGCGGG - Intronic
1019916254 7:4134655-4134677 TGGGAGCCAGGGGCCCTGCCAGG - Intronic
1020204775 7:6105522-6105544 TGGGGGCGGGGAGGCCGGCCCGG - Intronic
1020272768 7:6607089-6607111 TGGGGGTGATGAGCCAAGCCAGG + Intronic
1022094444 7:27130214-27130236 CGGGGGCGCTGCCCCCTGCCGGG + Exonic
1022653694 7:32299056-32299078 TGGGCGCGGAGATCCCTGCCTGG + Exonic
1024524372 7:50336224-50336246 GGGGGAGGAGGAGCCCTGCCTGG + Intronic
1025561902 7:62380349-62380371 GGGGGGCAAAAAGCCCTGCCGGG - Intergenic
1026181063 7:68041389-68041411 TGGGGACAATGACACCTGCCAGG + Intergenic
1026538627 7:71261232-71261254 AGGGGCCCATGAGTCCTGCCAGG - Intronic
1027592609 7:80134925-80134947 TGGGGGCGCTGAGCCGGGCCGGG + Exonic
1034244593 7:149634872-149634894 TGGGAGGGATGAGAGCTGCCTGG + Intergenic
1035467893 7:159091648-159091670 GAGGGGCCATGAGACCTGCCTGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037811430 8:22089291-22089313 TGGGGGCGGTGAGGCCGGCAGGG + Exonic
1039408856 8:37335252-37335274 TGGTGACAATGAACCCTGCCTGG - Intergenic
1041897044 8:62937514-62937536 TGGGGGCGAGGAGTCCTTACAGG - Intronic
1049243443 8:141550079-141550101 TGGGGGCAGTGACGCCTGCCGGG - Intergenic
1049347815 8:142148072-142148094 GGGCAGCCATGAGCCCTGCCTGG - Intergenic
1056687413 9:88778089-88778111 TGGGGAGGAAGAGCCCTGGCTGG + Intergenic
1056929280 9:90861252-90861274 TGGGGGTGTTGTTCCCTGCCTGG + Intronic
1060106816 9:120877539-120877561 TGTGCGCCATGAGCGCTGCCTGG - Intronic
1060544946 9:124454042-124454064 TGAGGGCTCTGAGCTCTGCCTGG + Exonic
1060728854 9:126024696-126024718 TGGGGAGGAGGGGCCCTGCCTGG + Intergenic
1061354369 9:130093053-130093075 TAGTGACGATGAGCACTGCCTGG + Intronic
1062120126 9:134829732-134829754 TTGGGGGGATGAGCCTGGCCTGG - Intronic
1062278698 9:135742516-135742538 TGGGGGCACTGAGCCAAGCCTGG - Intronic
1186512212 X:10138723-10138745 TGCGGGCCATGAGCTCAGCCAGG - Exonic
1186884794 X:13902683-13902705 TGTGGGTCATGAGCCCTGACCGG - Intronic
1192363910 X:70455439-70455461 AGGGGGCGCTGAGCCCCGCGCGG - Intronic