ID: 969671941

View in Genome Browser
Species Human (GRCh38)
Location 4:8594472-8594494
Sequence CTCAACTCTGCTGTGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 9, 3: 28, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969671939_969671941 6 Left 969671939 4:8594443-8594465 CCTAGGGTCTGGGATTCAGATTC 0: 1
1: 0
2: 0
3: 32
4: 188
Right 969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG 0: 1
1: 0
2: 9
3: 28
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969671941 Original CRISPR CTCAACTCTGCTGTGTGACC TGG Intronic
900131765 1:1090237-1090259 CTCATCTGTGCTGCGGGACCTGG - Intronic
900853502 1:5162462-5162484 ATCCACTCTGCTGTGTGCCTGGG - Intergenic
901307647 1:8244545-8244567 CTCAACTCTGCTGTTGTACCCGG - Intergenic
902449041 1:16485104-16485126 CTCCAATCGACTGTGTGACCTGG - Intergenic
902558037 1:17258555-17258577 CACAGCTCTGCAGTGTCACCCGG - Intronic
902987419 1:20163540-20163562 CTCAAGTCTGCTCTGTGTCCCGG + Intronic
903467529 1:23562411-23562433 ATCAACACAGCTGTGGGACCGGG - Intergenic
903692559 1:25184565-25184587 AGCAGCTTTGCTGTGTGACCTGG + Intergenic
904771165 1:32882226-32882248 GGTAACGCTGCTGTGTGACCTGG + Intergenic
904773770 1:32894738-32894760 AGCAACTCTGCTCTGTGACCAGG - Exonic
905016427 1:34781715-34781737 CTCGCCTCTGCTGTGGGCCCCGG + Exonic
905279605 1:36840786-36840808 CTCAGTTTTGTTGTGTGACCGGG - Intronic
905499273 1:38423828-38423850 CTCAACTGTGCTGTGCTAACAGG + Intergenic
905647764 1:39636200-39636222 CTCTAATTTGCTGTGTGGCCTGG - Intronic
906184430 1:43850854-43850876 ATCAACTCTGCTGTGTTCCCTGG - Intronic
906293829 1:44636878-44636900 ACCAATTCTGCTGTCTGACCTGG - Intronic
906898244 1:49803306-49803328 CTCAACTCTGTTATATGACTAGG - Intronic
907150779 1:52285387-52285409 CTCACCTCTGCTGTGTGGCCTGG - Intronic
907243263 1:53092279-53092301 CTCTACTGTGCTGTCTGCCCTGG + Intronic
908764197 1:67539654-67539676 CTCAAGCCTGCAGTGTGAGCTGG + Intergenic
911958350 1:104266022-104266044 CTCTACCCTACTCTGTGACCAGG + Intergenic
913812906 1:122920306-122920328 CTCAAGTCTGCTGTGTGTAAAGG - Intergenic
915210582 1:154305907-154305929 TGCAACACTGCTGAGTGACCTGG + Intergenic
915364181 1:155304950-155304972 TTCCACTCTGCTGTGGGGCCAGG + Intergenic
916075521 1:161198098-161198120 CCTAACTCTGCTGGGGGACCTGG - Exonic
916505399 1:165423988-165424010 CTGAACTCTGCAGCCTGACCTGG - Intronic
916785426 1:168083720-168083742 CTCAACTATTCTGGGTCACCTGG - Exonic
917513538 1:175688167-175688189 CTCAGCTCTGCTGAGTGCCAAGG + Intronic
917878825 1:179313206-179313228 CTCAACTCTACTGTGATAACAGG - Intronic
918395996 1:184113682-184113704 CACACCTCTGCTGTTTGAGCTGG + Intergenic
920388368 1:205583450-205583472 CCCAAGTCCACTGTGTGACCAGG + Intronic
920512872 1:206563829-206563851 CTCTACTGAGCTGTGTGACTGGG - Intronic
920841155 1:209555127-209555149 CCCAGTTGTGCTGTGTGACCTGG - Intergenic
920841228 1:209555608-209555630 CACAGTTGTGCTGTGTGACCTGG + Intergenic
922995331 1:229953321-229953343 CTACACACTGCTGTTTGACCAGG - Intergenic
1063238417 10:4143280-4143302 CTCAACTCTGCAGGATGGCCAGG - Intergenic
1063406891 10:5804754-5804776 CCCAACTCTGCTGTGGTACTAGG - Intronic
1064486101 10:15792199-15792221 CTCAGCTCTGGTGTGTGACTTGG - Intronic
1067573431 10:47388284-47388306 GTCAAAACTGCTGTATGACCAGG - Intergenic
1069612536 10:69784297-69784319 TGAAGCTCTGCTGTGTGACCTGG - Intergenic
1069814258 10:71183680-71183702 CCCAATTTTGCTGTGTGACCTGG + Intergenic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1070737091 10:78870573-78870595 CTCATCTTTCCTGTGTGGCCTGG + Intergenic
1071941871 10:90599597-90599619 CCTAACTCTGCTTTGTGACAAGG - Intergenic
1072553582 10:96497417-96497439 CTCCACTCTGCTCTGTGTCCAGG + Intronic
1072906529 10:99458933-99458955 CTCAACCTTGCTGAGTGTCCTGG + Intergenic
1074874586 10:117603890-117603912 CCCACATCTGCTGTGTGCCCTGG + Intergenic
1075336212 10:121610485-121610507 CTTCTCTTTGCTGTGTGACCTGG + Intergenic
1076205394 10:128596087-128596109 CTCCAATCTGCTGTGAGTCCTGG + Intergenic
1076362925 10:129902369-129902391 TTCAAGGCTGGTGTGTGACCTGG + Intronic
1077025101 11:436595-436617 CTCACCCCTGCTCTGTGGCCCGG - Intronic
1078847084 11:15128044-15128066 CACAAATTTGCTGTGTGACTTGG + Intronic
1079706541 11:23627432-23627454 CTGCATTCTGCTGTGTAACCTGG + Intergenic
1080855314 11:36106808-36106830 CCTCCCTCTGCTGTGTGACCTGG + Intronic
1081589333 11:44410083-44410105 CACCACTCCGCTGTGTGACCTGG + Intergenic
1083273291 11:61582811-61582833 CTACACTCTGCTTTGGGACCTGG + Intergenic
1083881175 11:65548993-65549015 CACGGCTCAGCTGTGTGACCTGG + Intronic
1085260909 11:75204171-75204193 CTGGACTCTGCTCTGTGGCCTGG - Intronic
1085692413 11:78674428-78674450 TTCCTCTCTGCTGTGTGAACTGG - Intronic
1085739310 11:79065323-79065345 CTCTACTGTGCAGTATGACCAGG - Intronic
1086850731 11:91804420-91804442 CTCTCCCCTGCTGTGTGATCAGG - Intergenic
1089300237 11:117494281-117494303 CTCCACTCTGCTGTTGTACCTGG + Intronic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1095772279 12:45973527-45973549 CTTGACTCTGATGTGTGTCCAGG - Intronic
1097052169 12:56230187-56230209 CTCTCCTCTGATGTCTGACCTGG - Intronic
1097629449 12:62042223-62042245 CTCAACTCTGCTCAGTGTCTAGG + Intronic
1102077872 12:110074238-110074260 CTCCACCCTGCTCTGTGCCCCGG + Intergenic
1102508555 12:113399067-113399089 CTGTCCTCTGCTGTGTGTCCTGG - Intronic
1103452798 12:121041184-121041206 CTCAAGTGTGCTGTGTGCCTTGG + Intergenic
1103763807 12:123268438-123268460 CTCCTCTATGCTGTGTGCCCTGG - Intronic
1104596106 12:130120763-130120785 CTCAACACCTCTGTGTGAACTGG + Intergenic
1105067715 12:133215350-133215372 GTTACCTCTGCTGTGTGGCCTGG - Intergenic
1106080422 13:26496016-26496038 CTCCACTTTGCTCTGTGTCCTGG - Intergenic
1109549817 13:63879636-63879658 CTGAATTCTTCTGTGTAACCAGG + Intergenic
1113542930 13:111122983-111123005 CTCCACTCTGCTTTGTGTCCTGG - Intronic
1114449491 14:22815646-22815668 GTCAGCTCTGCTCTGGGACCAGG + Exonic
1115308175 14:31953129-31953151 CTCAGCTCTGCTGTGGGTCTGGG - Intergenic
1117726320 14:58678030-58678052 ATGAACTCTGCTGTCTGCCCTGG - Intergenic
1121517466 14:94562208-94562230 CCCAACTCTGCTGTGGCAGCTGG - Intronic
1121547673 14:94773804-94773826 GTGAACTCTGCTCTGTGGCCGGG - Intergenic
1122212618 14:100182455-100182477 CAGAACTCTGCTGGGTGGCCAGG + Intergenic
1122984041 14:105204015-105204037 CACACCAGTGCTGTGTGACCTGG - Intergenic
1123334957 15:18905197-18905219 CTCAACCCTGCTGTATGAATGGG - Intergenic
1123369843 15:19483657-19483679 CTCAAATCTGCTGTATGAATGGG - Intergenic
1124057437 15:26254975-26254997 TTCAACTCTGCAGTGTGAATGGG + Intergenic
1124372292 15:29110672-29110694 CTCCACATGGCTGTGTGACCTGG - Intronic
1125000801 15:34768305-34768327 CTCAGCCCTGCTCTGTGTCCTGG + Intergenic
1125178306 15:36851551-36851573 TTCTACCCTGCTGTGTGGCCTGG + Intergenic
1126198003 15:45953305-45953327 CTCAAGTAGGCTGTGTGAACTGG + Intergenic
1127960816 15:63888980-63889002 CTCTCCCCAGCTGTGTGACCTGG + Intergenic
1128315697 15:66657868-66657890 CACAGTTTTGCTGTGTGACCTGG - Intronic
1128557596 15:68642256-68642278 CCCAACCCTGCTGTGTGACTTGG - Intronic
1128669482 15:69563659-69563681 CTCAGCTCTGTTCTGAGACCGGG - Intergenic
1129301034 15:74625682-74625704 CTGCATTCTGGTGTGTGACCCGG + Intronic
1129316923 15:74750691-74750713 CTCAGACCAGCTGTGTGACCTGG + Intronic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1131204893 15:90435656-90435678 CACTACTCTGCAGTGTAACCTGG + Intronic
1131304584 15:91230612-91230634 CTCAACCCTGCTTAGTGTCCAGG + Intronic
1132021888 15:98369840-98369862 GTGAACTCAGCTGTGTGTCCTGG + Intergenic
1133460161 16:5980465-5980487 CTCAGGTCTGCTGTCTGCCCAGG - Intergenic
1133863174 16:9616232-9616254 CTCCACTCTGCTCTGTGACCTGG + Intergenic
1135343443 16:21667723-21667745 CTCAACTCTGCTATGGTAGCAGG + Intergenic
1136560246 16:31034634-31034656 CCCAGGCCTGCTGTGTGACCTGG - Intronic
1136598310 16:31266722-31266744 CCCTCCTCTGCAGTGTGACCTGG - Intronic
1137722462 16:50635403-50635425 CTCCACTCTCCTCTCTGACCTGG - Exonic
1138448628 16:57079697-57079719 CTCCAGCCTGCTGTGTGGCCTGG + Intronic
1139342163 16:66274702-66274724 TTTAAATGTGCTGTGTGACCTGG + Intergenic
1140528097 16:75640822-75640844 CTCAACTCTGCTGTTTCAGGGGG + Intronic
1140764235 16:78140956-78140978 CTCAGCTCTGCTCTAGGACCTGG + Intronic
1141426829 16:83949657-83949679 CTCAGGTGTGCTGTGTGACCTGG - Intronic
1142291955 16:89197259-89197281 CTGGACCCTGCTGTGTGGCCGGG + Intronic
1142814768 17:2416524-2416546 CAGACCTCTGCTGTGTGTCCTGG - Exonic
1144865914 17:18335594-18335616 ATCAATTCTGCTGTGTTCCCTGG - Exonic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144946828 17:18973607-18973629 CTCCACTTTGCTCTGTGGCCAGG + Intronic
1145976863 17:28988844-28988866 CCCAAGTTTGCTGTGTGACTTGG - Intronic
1147927197 17:43953291-43953313 CTCACCGCTGCCGGGTGACCAGG + Exonic
1149007079 17:51817310-51817332 CTCAACTCTGCTATGAAAGCAGG - Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1150839255 17:68592798-68592820 CTCTACTATGCTGTGTTCCCTGG + Intronic
1150982296 17:70156151-70156173 CTCAACTCTGCTGTTGCAGCTGG + Intergenic
1151579135 17:74968363-74968385 CTCAGCCCTGCTCTGTGGCCAGG - Intronic
1152509795 17:80778767-80778789 CCCCACTCTGCTGTGTGGGCTGG - Intronic
1152614632 17:81332101-81332123 TTCAACTCTGCTCTGTGAAACGG + Intergenic
1152912918 17:83015655-83015677 CTCACTCCTGCTGTGTGGCCTGG - Intronic
1154206439 18:12341146-12341168 TTCAACTCTGCTGTCGGACGTGG + Intronic
1154946629 18:21168153-21168175 CTCAACTCTTCTGTGGCACATGG - Intergenic
1157490028 18:48116665-48116687 CTCAGCTCTGCTGGCTGTCCTGG + Intronic
1157762763 18:50276332-50276354 CACAACTCTGCAGTGGGAGCAGG - Intronic
1158446652 18:57528032-57528054 CTTATCTCTGCTCTGTGTCCGGG + Intergenic
1160216977 18:76940839-76940861 CTCACCCCTGCTGTGCGGCCTGG - Intronic
1163110345 19:15156818-15156840 CTCAACTCTTCTCTGTGCTCTGG - Intergenic
1163199853 19:15759538-15759560 CTCAGCTTTGCTGTGTGGCTTGG - Intergenic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228018 19:15978876-15978898 CTCGGTTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163366970 19:16880847-16880869 CCCAGCTCTGCTGTGTCCCCTGG + Intergenic
1163371649 19:16904297-16904319 CTACACTCTGCTGGGTGACGTGG - Exonic
1163469902 19:17489984-17490006 CCCTGCTCAGCTGTGTGACCTGG - Intronic
1163611071 19:18301884-18301906 GTCACCATTGCTGTGTGACCTGG + Intergenic
1165077754 19:33290277-33290299 CACACACCTGCTGTGTGACCCGG - Intergenic
1166031473 19:40133761-40133783 CTCCACTCTACTATGTGCCCAGG - Intergenic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
928490452 2:31778010-31778032 CTGAACCCTGCTGGGTGATCTGG + Intergenic
933914479 2:86974682-86974704 CTCAATTCTGCTGAGTTTCCAGG - Exonic
934008514 2:87795217-87795239 CTCAATTCTGCTGAGTTTCCAGG + Exonic
935057494 2:99580344-99580366 CTCAACTCTGCTGTTGTAGCAGG - Intronic
935129435 2:100250386-100250408 CACTGTTCTGCTGTGTGACCTGG - Intergenic
935578276 2:104733681-104733703 CTCAAATCTCCCGTGTGACCTGG + Intergenic
936810066 2:116387908-116387930 CTCCACCCTGCTCTGTGTCCTGG + Intergenic
937082380 2:119149675-119149697 CTTTACTCTGCATTGTGACCTGG + Intergenic
937114426 2:119394597-119394619 CTCAACTCTGCTGTTGTACAGGG - Intergenic
937801942 2:126090761-126090783 CTCAAGGTTGCTATGTGACCTGG - Intergenic
938841628 2:135170595-135170617 GTCAACTCTGCTGTGTGGATCGG + Intronic
938911893 2:135893143-135893165 TTCCACTCTGCTGTGTGTCCTGG - Intergenic
940312492 2:152293140-152293162 GTCAACACTGGTGTGAGACCTGG - Intergenic
940769534 2:157825462-157825484 CTTACCTCTGCTGTGCGGCCGGG - Intronic
942040983 2:172062580-172062602 CTCCACTCTGCTCTGTGATCTGG - Intronic
946063396 2:216965641-216965663 CTCCACTCTGCTCTCTGCCCTGG + Intergenic
946234010 2:218311181-218311203 ATCTAATCAGCTGTGTGACCTGG + Intronic
946641553 2:221788952-221788974 CTCCACTCTGCTCTGTGCCCTGG - Intergenic
947659382 2:231855404-231855426 CTCTCCTCTCCTGTGTAACCAGG + Intergenic
948074815 2:235157712-235157734 CTCAACTCTGCACTGTTGCCAGG + Intergenic
948232085 2:236356134-236356156 CTCCCCTCTGCTTGGTGACCTGG - Intronic
1168845659 20:942816-942838 CTCTAACTTGCTGTGTGACCTGG + Intergenic
1170154572 20:13257751-13257773 CTCAACTCTGCTCCCTGACTTGG - Intronic
1171717784 20:28510080-28510102 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171717891 20:28511958-28511980 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718111 20:28515712-28515734 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718196 20:28517252-28517274 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718302 20:28519130-28519152 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718416 20:28521007-28521029 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718526 20:28522885-28522907 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718634 20:28524762-28524784 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718744 20:28526640-28526662 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718852 20:28528519-28528541 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718957 20:28530397-28530419 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719068 20:28532275-28532297 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719172 20:28534153-28534175 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719256 20:28535690-28535712 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719367 20:28537568-28537590 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719475 20:28539446-28539468 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719584 20:28541324-28541346 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719686 20:28543201-28543223 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719797 20:28545078-28545100 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719998 20:28548816-28548838 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720103 20:28550694-28550716 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720235 20:28553085-28553107 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720341 20:28554963-28554985 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720450 20:28556840-28556862 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171728042 20:28645006-28645028 CTCAAAACTGCTGTGTGAAAAGG + Intergenic
1172188228 20:33044825-33044847 CTCCTCTTTGCTGTGTGTCCTGG + Intergenic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1175259399 20:57665045-57665067 CTCAACTCTGCTGTGACCACAGG + Intronic
1175364741 20:58445015-58445037 CTGAACTCTGTTGGGTGAACTGG + Exonic
1175976938 20:62715604-62715626 CACAGCTCTGCATTGTGACCCGG + Intronic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1177995739 21:28095037-28095059 CTCATCTCTGCTCTTAGACCTGG - Intergenic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1179814219 21:43893685-43893707 TTCAACACTGCTGTGTAACAGGG + Intronic
1180058565 21:45373339-45373361 CCCACCTTTGCTGTGTGACTTGG - Intergenic
1181886389 22:26025312-26025334 CTAAACTGTCCTGTGTGATCAGG + Intronic
1182079314 22:27518008-27518030 CTCCACTCTGCTGTGTGGCCTGG - Intergenic
1182281084 22:29218020-29218042 CTGCACTCTGCTGTGTGACTTGG + Intronic
1182547146 22:31082934-31082956 CGCCAGTCTGCTGTGTGGCCTGG - Intronic
1183850558 22:40583569-40583591 CTCAGTCCTGCTGTGTGGCCTGG - Intronic
1184039585 22:41935037-41935059 CTCAGCTCTGCTGTGAGGCAGGG + Intergenic
1184669242 22:46004202-46004224 GTCAACTCTCCTGGGTGGCCTGG + Intergenic
949349429 3:3110525-3110547 CTCTTCTCTGCTTTGTGAGCAGG + Intronic
949805567 3:7952056-7952078 CCCAACTCTGCTGGGTGAGCTGG + Intergenic
950064942 3:10104536-10104558 CGCAACTCTGATGTGTGGCAGGG + Exonic
950211469 3:11126695-11126717 GTCCACTCTGCTGTGTCCCCAGG - Intergenic
950332454 3:12167296-12167318 CTCAACTCACCTGTCTGACATGG - Exonic
952028666 3:29114241-29114263 CTCAACCCTGCTGAGTGATATGG - Intergenic
953614695 3:44478972-44478994 CTCAACCCTGCTGTGACACTTGG - Intergenic
954113220 3:48447279-48447301 TTCAAATCGGCTGTTTGACCTGG - Intronic
954612327 3:51952156-51952178 CAAAACTCAGCTGTGTGACCTGG + Intergenic
955103367 3:55873340-55873362 CCCACCTTTGCTGTATGACCTGG + Intronic
956070562 3:65445749-65445771 CTGAACTCTGTTGTTTGAGCTGG - Intronic
956152493 3:66258255-66258277 TTCAACTCTGTTGTGTGATAGGG + Intronic
956739099 3:72260981-72261003 CTCTACCCTGCTCTGTGTCCTGG + Intergenic
956845997 3:73183495-73183517 CTCCACTCTGCTCTATGCCCTGG + Intergenic
957518592 3:81289114-81289136 CTCCAGACTGCTGGGTGACCAGG + Intergenic
959459799 3:106611434-106611456 CTCAACTTTGCTGTGTTTCAGGG + Intergenic
961391865 3:126557214-126557236 CTATCCTCTGCTGCGTGACCTGG + Intronic
966179843 3:177178190-177178212 CCAAACTCTGCTGTGCGATCTGG - Intronic
967228845 3:187318657-187318679 CTCAAATCTGCTCTGTGCCCCGG + Intergenic
967945164 3:194798345-194798367 GTTGGCTCTGCTGTGTGACCTGG - Intergenic
968575597 4:1364678-1364700 CTCAGCTGTGCTGTGGGAACAGG + Intronic
968705418 4:2075307-2075329 CTCATTGCTGCTGTGTCACCTGG - Intronic
968801531 4:2746308-2746330 CTGAACTCAGCTGAGTCACCCGG - Intronic
969578178 4:8048520-8048542 CTCCTCCCAGCTGTGTGACCTGG - Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
969884317 4:10201759-10201781 CTGACCTCTGCTGAGTGATCTGG + Intergenic
972347364 4:38203838-38203860 CTCAACTCTGCTGAAAGAACTGG + Intergenic
973784706 4:54324038-54324060 CTTAACTCTGCTCTCTGGCCAGG + Intergenic
974752448 4:66158193-66158215 CTCAACTCTGGTGTGAGATAAGG + Intergenic
980705585 4:136488803-136488825 CTCCACCCTGCTTTGTGACCTGG - Intergenic
981589007 4:146336159-146336181 CTCAACTCTGCTATTGTACCTGG + Intronic
983997155 4:174196520-174196542 CAGAACTCTGCTGTCTAACCTGG + Intergenic
985158935 4:187024113-187024135 CTCCACTCTGCTGTGTGCTCTGG + Intergenic
985768237 5:1792966-1792988 CTCAACTCTGCTGTGGCAGCAGG + Intergenic
985816942 5:2134285-2134307 CTCAACGCTGCAGTGTGGCTGGG + Intergenic
990630418 5:57662570-57662592 CTCAACCCTGGTGTCTGCCCAGG - Intergenic
990887295 5:60609259-60609281 CTCAACCTTCCTGTGAGACCAGG + Intronic
992542416 5:77777994-77778016 CACAGCGCTGCTGTGTGACTTGG - Intronic
994150726 5:96444960-96444982 CTCAACTCTTCTATCTGGCCAGG - Intergenic
995422034 5:111978502-111978524 ATCTACTCTGCTGTGTAACATGG + Intronic
999215852 5:149934480-149934502 CTGAACTTTGCTGTTTGACCTGG - Intronic
999229095 5:150051125-150051147 CACTAATCTGCTGTGGGACCCGG - Intronic
999608623 5:153344842-153344864 CTCCACTCTGCTATGTGGACAGG - Intergenic
1000873308 5:166604531-166604553 CACAACTCTGCTGGTTGACTTGG + Intergenic
1001304292 5:170560533-170560555 CACAACACTGCTGTGTGACAGGG - Intronic
1001486873 5:172126226-172126248 CACAGCTCTCCTGTGTGATCTGG + Intronic
1002110967 5:176912257-176912279 CTCAACTCTGCACTGTTAGCAGG + Intronic
1002706069 5:181161362-181161384 CCCATGTCTGCTGTGTGAGCAGG - Intergenic
1003586084 6:7390239-7390261 CTTAACTCTGCCGCGTGAACTGG - Intronic
1006775131 6:36586614-36586636 CTCAGCCCTGCTCTGTGCCCTGG + Intergenic
1006998988 6:38290783-38290805 CACAACCCTGCTGTGTGCCTGGG + Intronic
1012600170 6:101086781-101086803 CTCTGCTCTGCTCTGTGCCCAGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015021271 6:128478883-128478905 CTCAACTCACCTGTGAGTCCAGG - Intronic
1015841066 6:137477896-137477918 CCCAACACAGCTATGTGACCTGG - Intergenic
1018799686 6:167212344-167212366 CTCAGTTCTGTGGTGTGACCAGG - Intergenic
1019038526 6:169083322-169083344 GTCACCTCTGAAGTGTGACCTGG + Intergenic
1019497584 7:1347658-1347680 CTGCACCCTGCTGTGTAACCTGG + Intergenic
1023858993 7:44205852-44205874 CTCCACTCTGGTGGGTGACTGGG - Intronic
1025201220 7:56963013-56963035 CTCCACCCTGCTGAGTGCCCTGG + Intergenic
1025670724 7:63613920-63613942 CTCCACCCTGCTGAGTGCCCTGG - Intergenic
1025973838 7:66353894-66353916 TTCAACTCTGGTGTGAGACATGG - Intronic
1026322012 7:69276456-69276478 CTAAAGTATGCTGTGTGTCCAGG - Intergenic
1026530291 7:71191458-71191480 CTCAACTCTGCTGTTGCAGCAGG + Intronic
1026792847 7:73346041-73346063 TTCATCTCTGCTGTGTGCCTTGG - Intronic
1027530635 7:79327113-79327135 CTCTTCTCATCTGTGTGACCTGG + Intronic
1028282637 7:88950069-88950091 CTAAACTCTCCTGTTAGACCTGG + Intronic
1031045194 7:116879683-116879705 CACCTCCCTGCTGTGTGACCGGG + Intronic
1032076658 7:128839199-128839221 CTCACCTGTGCTGTGTGGCATGG + Intronic
1033555844 7:142488062-142488084 CATGACTCTGCTGTGTGCCCAGG + Intergenic
1034820976 7:154216043-154216065 CTCAACACTGCTGTGGTTCCTGG - Intronic
1035321244 7:158030627-158030649 CCCACCTCTGCTGGGTCACCAGG - Intronic
1037666265 8:20972745-20972767 CTCAACCCTGCTGAGGGGCCAGG + Intergenic
1041433762 8:57815645-57815667 CTGGACCCAGCTGTGTGACCAGG + Intergenic
1041434575 8:57824095-57824117 CTCATCTCTGCTGTTTTAGCAGG - Intergenic
1041679446 8:60573424-60573446 CTGAAGGCTGCTGTGGGACCTGG + Intronic
1043391805 8:79799002-79799024 CTCACCTTTGCTCTGGGACCTGG - Intergenic
1044134446 8:88568327-88568349 CTCAAATTTGCTGTGTGCCAAGG + Intergenic
1044866388 8:96575079-96575101 CTCACCTCTGCTGTGCAGCCTGG + Intronic
1045147330 8:99361395-99361417 CTCAACTCTGCTGCTTTAGCAGG + Intronic
1045346018 8:101294465-101294487 GTCAGCTCAACTGTGTGACCTGG + Intergenic
1045478013 8:102569534-102569556 CTCTGCTCTGCTGTGGGCCCGGG - Intergenic
1047983123 8:130204081-130204103 CTCACTCCTGCTGTGTGGCCTGG - Intronic
1047997095 8:130347532-130347554 CCCAGCTTTGCTGTGTGATCTGG + Intronic
1048308908 8:133303241-133303263 ATCAACCCTGCTGTGTTTCCAGG - Intergenic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1049411879 8:142477257-142477279 AACAACTCTGCCGTGTGCCCAGG + Exonic
1050448126 9:5749123-5749145 CACTACTCTGCTGGGTGAACTGG - Intronic
1051796787 9:20880540-20880562 CTCAACCCTGCTCTGTGCTCTGG - Intronic
1053477366 9:38392415-38392437 GAAAACTTTGCTGTGTGACCTGG + Intergenic
1054872073 9:70056716-70056738 CTCAATCCTGCTGTGTGGCTGGG - Intronic
1055795903 9:79974878-79974900 GTCAACTCTGCTGTCTTCCCCGG + Intergenic
1056948648 9:91023954-91023976 CTCTACTCTGCTCCGTGACTGGG + Intergenic
1057882704 9:98805346-98805368 CTCCACTCTGTTTTGTGCCCCGG + Intergenic
1057920490 9:99092990-99093012 CTCAACTCAGCTGTGGTGCCAGG + Intergenic
1058562846 9:106248067-106248089 TTCAAATATGCTGTGTGGCCAGG - Intergenic
1058703690 9:107621559-107621581 GACAACACAGCTGTGTGACCTGG - Intergenic
1060667265 9:125439345-125439367 CTCCCACCTGCTGTGTGACCTGG + Intronic
1060994741 9:127869540-127869562 CTCTGTTCAGCTGTGTGACCTGG + Intronic
1061486363 9:130922477-130922499 CTGAGTCCTGCTGTGTGACCTGG - Intronic
1062343736 9:136105259-136105281 GTCAACTCTGCTGTGTCCCTTGG - Intergenic
1185811159 X:3112018-3112040 CTCACCTCCTGTGTGTGACCAGG + Intronic
1186671296 X:11770007-11770029 CTCAACTCTGCTGTTCCAGCAGG + Intronic
1187098330 X:16168976-16168998 CTCAGCTCTGCTGTGCGCCCTGG + Intronic
1187439769 X:19307483-19307505 CTCCACTCTGCTGTATGCCTGGG - Intergenic
1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG + Intergenic
1192220659 X:69195410-69195432 CTCATCTCTGCTGTCAGGCCCGG + Intergenic
1195244522 X:102983480-102983502 CCCAGTTTTGCTGTGTGACCTGG + Intergenic
1195252942 X:103065543-103065565 CTAAGCTCTTCTGGGTGACCTGG - Intergenic
1198557657 X:137812329-137812351 CTCCACTCTGCTTTGTGACCAGG - Intergenic