ID: 969674579

View in Genome Browser
Species Human (GRCh38)
Location 4:8607781-8607803
Sequence TTTCCGGGAGGCGCCGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969674575_969674579 -8 Left 969674575 4:8607766-8607788 CCGCAGAGGGGTGCGTTTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 63
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674562_969674579 25 Left 969674562 4:8607733-8607755 CCCCGCGCCTGGCGGGGTCCCCA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674573_969674579 -5 Left 969674573 4:8607763-8607785 CCACCGCAGAGGGGTGCGTTTCC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674569_969674579 5 Left 969674569 4:8607753-8607775 CCAGTGCTTCCCACCGCAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674563_969674579 24 Left 969674563 4:8607734-8607756 CCCGCGCCTGGCGGGGTCCCCAG 0: 1
1: 0
2: 1
3: 24
4: 251
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674565_969674579 18 Left 969674565 4:8607740-8607762 CCTGGCGGGGTCCCCAGTGCTTC 0: 1
1: 1
2: 1
3: 13
4: 163
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674572_969674579 -4 Left 969674572 4:8607762-8607784 CCCACCGCAGAGGGGTGCGTTTC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674561_969674579 28 Left 969674561 4:8607730-8607752 CCGCCCCGCGCCTGGCGGGGTCC 0: 1
1: 0
2: 5
3: 23
4: 198
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674564_969674579 23 Left 969674564 4:8607735-8607757 CCGCGCCTGGCGGGGTCCCCAGT 0: 1
1: 0
2: 3
3: 7
4: 197
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674567_969674579 6 Left 969674567 4:8607752-8607774 CCCAGTGCTTCCCACCGCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119
969674566_969674579 7 Left 969674566 4:8607751-8607773 CCCCAGTGCTTCCCACCGCAGAG 0: 1
1: 0
2: 2
3: 16
4: 205
Right 969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969674579 Original CRISPR TTTCCGGGAGGCGCCGGCAG AGG Intronic
901353703 1:8623371-8623393 TTTCCGGGAGGCAGAGGCTGCGG + Intronic
902157393 1:14499470-14499492 TTTCTGGGAGGAGCTGGCTGTGG + Intergenic
902350172 1:15848210-15848232 GCTCCGGGAGGGGCCGGCAACGG - Intronic
910788014 1:91021716-91021738 GTTCGGGGAGGCGGCGGCCGCGG - Intronic
913666364 1:121052225-121052247 TTTCCGGGAGGAGGCTGGAGCGG - Intergenic
917814473 1:178693553-178693575 TTTCCGGGAAGCATCAGCAGAGG - Intergenic
923034567 1:230276573-230276595 TGTCAGGGAGACGCCTGCAGAGG + Intronic
923129849 1:231065704-231065726 TTTCCGGGAGGTGCTGGGATGGG + Intergenic
924179371 1:241424834-241424856 ATCCAGGCAGGCGCCGGCAGTGG - Intergenic
924194091 1:241587051-241587073 TTGCTAGGAGGCGCAGGCAGAGG - Intronic
924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG + Exonic
1070610192 10:77927138-77927160 CCTCCGGGAGGCGGCAGCAGGGG + Intergenic
1071559149 10:86632086-86632108 TTCCCGTGAGGCCCAGGCAGCGG + Intergenic
1071835735 10:89415232-89415254 TTTCCCGGAGGCGGCGGCCGCGG - Intronic
1073955488 10:108866491-108866513 TTTCCCGGAGGCACTTGCAGAGG + Intergenic
1076762621 10:132612872-132612894 CATCCAGGAGGGGCCGGCAGTGG + Intronic
1083823019 11:65183081-65183103 TTTCTGGGAGGGGCTGGCCGAGG + Intronic
1085318787 11:75562068-75562090 GGGCCGGGAGGCGCCGGCAGAGG + Intronic
1089537376 11:119169007-119169029 GTTCCGGGAGCCGTCGGCCGCGG - Exonic
1094375270 12:29783231-29783253 GGTTCGGGAGGCGCCGGCTGGGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1104623438 12:130335243-130335265 TTTCCGGGAGCCGCCTCTAGAGG - Intergenic
1106420386 13:29580952-29580974 TCTCCGGGAGGCTCTGGCGGTGG - Intronic
1114037906 14:18646470-18646492 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1122544264 14:102513511-102513533 TTTCCTGGAAGCCCCGGCTGGGG - Intergenic
1123633932 15:22283785-22283807 TTTCCGGGAGGCAGAGGCTGCGG - Intergenic
1123684305 15:22786570-22786592 TGACCGGGAGGCGCGGGCGGGGG - Intronic
1126436978 15:48646190-48646212 CTACCGGGAGGCGCGGGCAGCGG - Intergenic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1129286164 15:74526785-74526807 TTTGCGGGGGGCGTTGGCAGGGG + Intergenic
1132671235 16:1102977-1102999 TTTCCGCGCGCGGCCGGCAGAGG - Intergenic
1136109118 16:28053571-28053593 TTTCCAGGAGGCCCCTACAGGGG - Intronic
1141835774 16:86538315-86538337 TTCCAGGGTGGCGGCGGCAGTGG + Intronic
1142149295 16:88505672-88505694 TTCCCGGGAGCTGACGGCAGGGG - Intronic
1142683368 17:1562749-1562771 GCTCCGGGCGGCGTCGGCAGCGG - Exonic
1142848567 17:2693676-2693698 GTTCTGGGAGGCGATGGCAGGGG - Intronic
1143202537 17:5122606-5122628 GTTCCGGGAGGGCCCCGCAGCGG - Intronic
1143493399 17:7296566-7296588 CCTCCGGGAGCGGCCGGCAGAGG - Intergenic
1144840501 17:18183087-18183109 GCTCCGGGCGGCGGCGGCAGCGG + Intronic
1145029703 17:19495314-19495336 TGGCCGGGAGGCGCCGGCCAGGG + Intergenic
1145980744 17:29010005-29010027 TTTCAGGGAGGCAAGGGCAGGGG + Intronic
1146012123 17:29204522-29204544 CTTCCTGGAGCCGCCGGCCGGGG - Intergenic
1147537184 17:41328484-41328506 TTTCCTGGAGGTACCTGCAGTGG + Intergenic
1147597627 17:41727108-41727130 TTTCCAGGAGACGCTGGCTGAGG - Exonic
1147686261 17:42288509-42288531 GTTCCTGGCGGCGGCGGCAGCGG - Exonic
1148126971 17:45242080-45242102 CCTCCGGGAGGCGGCGGCGGCGG - Exonic
1148331820 17:46818063-46818085 CTTGATGGAGGCGCCGGCAGAGG + Intronic
1148581840 17:48749734-48749756 TTTCCGTGAGGCTCAGGCATGGG - Intergenic
1152547053 17:81005429-81005451 AATCCGGGAGGCGGAGGCAGAGG + Intronic
1152656694 17:81523208-81523230 TTTCGGGGAGGGGCAGGGAGGGG + Intronic
1157610159 18:48950769-48950791 TTTTGGGGAGGCGCCGACGGGGG - Intergenic
1157867059 18:51196780-51196802 TGCCCGGGAGGCGGCGGCCGCGG - Exonic
1160911982 19:1478804-1478826 TGTGCGGGGTGCGCCGGCAGAGG - Exonic
1162030903 19:7916867-7916889 CTCCCCGGAGGCGGCGGCAGCGG - Exonic
1162138146 19:8568809-8568831 TATCCGGGAGGCTGAGGCAGGGG + Intronic
1162773614 19:12965506-12965528 GTCCCGGGAGCCGCCGCCAGAGG + Intronic
1163435474 19:17292671-17292693 TCTTCTGGAGGCGCCGGCAGTGG + Exonic
1165242610 19:34480758-34480780 TTTCGGGAAGGCGCCTACAGTGG - Intergenic
1165353843 19:35291955-35291977 TTTCCTGGAGGGGTCGGGAGTGG - Intergenic
926101757 2:10122528-10122550 TCTCCGGAAGGCGCCGGCGGAGG + Exonic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
927545792 2:23951703-23951725 TCTCTGGGAGGCCCAGGCAGGGG - Intronic
930700875 2:54456856-54456878 CTGCAGGGAGGCGCCGGCGGAGG - Intronic
935794779 2:106630626-106630648 TTTACGGGAGGGGATGGCAGAGG - Intergenic
940295160 2:152114905-152114927 TTTTCGGGAGGCTGAGGCAGGGG + Intergenic
947523702 2:230866069-230866091 TGTCCGGGAAGGGCCCGCAGGGG + Intronic
948823318 2:240561136-240561158 TTTCCGGGCGGGGCCGGCTTCGG + Intronic
948830866 2:240597692-240597714 TTGCCAGAAGGTGCCGGCAGTGG - Intronic
1168757401 20:326562-326584 TGTCGGGGAGGCGGCGGCGGCGG - Exonic
1175205506 20:57308261-57308283 TCTCCGGGTGCTGCCGGCAGTGG - Intergenic
1175210532 20:57351212-57351234 TTTCCGGGCGACGCAGGAAGTGG + Exonic
1175943945 20:62550209-62550231 TGTCAGGGAGGGGCCGGGAGGGG + Intergenic
1178922825 21:36750161-36750183 CTTCTGTGAGGCTCCGGCAGGGG + Intergenic
1180462033 22:15573512-15573534 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1180875068 22:19171374-19171396 GTCCCGGGAGGCGCCGCCAGAGG + Intergenic
1182072791 22:27475435-27475457 TTCCCAGGAGGGGCAGGCAGAGG - Intergenic
1183338167 22:37262868-37262890 TTTCCTGGAGGCGAGGGCAGGGG - Intergenic
1183671958 22:39278242-39278264 ATCCCGGGAGGCGGCGGCCGAGG - Intergenic
952943278 3:38459326-38459348 TTTCAGGGAGGCGGAGGCTGTGG + Intronic
955666423 3:61354166-61354188 TTTTCGGGAGGCTGAGGCAGGGG - Intergenic
965144539 3:164884115-164884137 ATTGCGGGAGGCCCAGGCAGGGG + Intergenic
968085518 3:195872286-195872308 TGTCCGGGAAGCCCCAGCAGTGG + Exonic
969326195 4:6445607-6445629 ACTCTGGGAGGCCCCGGCAGGGG + Intronic
969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG + Intronic
972793862 4:42397799-42397821 CCTGCGGGAGGCGCCGGCAGAGG - Intergenic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
985383339 4:189419259-189419281 TTTCCTGGGGGCTCCAGCAGAGG - Intergenic
988547814 5:32174374-32174396 GGGCCGGGAGGCGCCGGAAGCGG + Intergenic
991371751 5:65926189-65926211 GCTCCGGGTGGCGGCGGCAGCGG + Intergenic
992520448 5:77545470-77545492 TTCCGGGGAGGCTTCGGCAGTGG + Intronic
992771865 5:80055968-80055990 TTTCTGGGAGGGGCCAGCAAAGG - Exonic
993165298 5:84346251-84346273 TTTGCGGGAGGCTGAGGCAGGGG - Intronic
1001285017 5:170416389-170416411 CTTCCGGGAGGAGCCGGAAGTGG - Intronic
1012391191 6:98741800-98741822 TTTCCAGGAGGCGACAGCATAGG + Intergenic
1013033807 6:106361053-106361075 TCTCCGGCAGGCGCCGGGAGCGG - Intergenic
1017240257 6:152160363-152160385 TTTCCAGGAGGAGCCAGGAGGGG - Intronic
1017371371 6:153713131-153713153 TTTTCGGGAGGCTGAGGCAGGGG - Intergenic
1019476422 7:1246823-1246845 GGTCGGGGAGGCGCCGGGAGGGG - Intergenic
1019537986 7:1538776-1538798 TGACCAGCAGGCGCCGGCAGTGG - Intronic
1021688031 7:23206241-23206263 TCTCCGGGTGGCGGCGGGAGAGG + Intergenic
1022113037 7:27243130-27243152 TTCTCGGGCGGCTCCGGCAGCGG - Exonic
1023601699 7:41887126-41887148 TTCCCGGCAGGGCCCGGCAGGGG - Intergenic
1024313521 7:47991938-47991960 TTCTGGGGCGGCGCCGGCAGTGG - Intronic
1025091036 7:56064469-56064491 CTTCCGGGATGCGGCTGCAGCGG + Intronic
1027251322 7:76400544-76400566 CTTCCAGGCGGCCCCGGCAGCGG + Exonic
1029154280 7:98503951-98503973 TTGCCGGCAGCCGCAGGCAGAGG + Intergenic
1032076510 7:128838593-128838615 TTTTCGGCAGGGGCCGGCACTGG + Exonic
1032194372 7:129780822-129780844 GTTCCCGGCGGCGGCGGCAGCGG - Intergenic
1035568039 8:654768-654790 TTGCTGGGAGGGGCAGGCAGTGG + Intronic
1035705406 8:1670904-1670926 TTTCAGGGAGGCGTCAGGAGGGG + Intronic
1039920615 8:41891718-41891740 GCTCTGGGAGGCGCCGGCAGGGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1044699048 8:94949653-94949675 TTTCCAGGAGCCGGCGGGAGCGG + Intronic
1047215084 8:122869585-122869607 TCGCCGGGAGGCCCAGGCAGGGG + Intronic
1047231583 8:123002288-123002310 TTTGTGGGAGGGGCCGGGAGTGG - Intergenic
1047373541 8:124275632-124275654 TTTCCTGCAGGCACCGACAGCGG - Intergenic
1047495375 8:125405145-125405167 TTCCCGGGAGGAGCTGGCAGAGG + Intergenic
1049161446 8:141100786-141100808 TTTCCTGGAGGCGTCACCAGTGG + Intergenic
1049212271 8:141392223-141392245 GTCCCGGGACGCGCGGGCAGGGG - Intronic
1049697433 8:143990866-143990888 CACCCGGGAGACGCCGGCAGCGG + Intronic
1056546158 9:87615712-87615734 TTTCAGGGAGGCGCCCACTGTGG - Intronic
1058021932 9:100098921-100098943 GCTCCGGGAGCCGACGGCAGCGG + Exonic
1060224441 9:121782635-121782657 TGTCCAGGAGGCGGCCGCAGAGG + Intronic
1061346244 9:130028011-130028033 TTTCCGGGAGGCCCAGGTGGGGG - Intronic
1062519091 9:136950236-136950258 TGTCCGGGAGGCTCCTGCAGGGG + Intronic
1185779061 X:2829584-2829606 TGGCCGGGGGGCGCGGGCAGAGG + Intronic
1196684437 X:118498019-118498041 TTTCTAGGAGACGCTGGCAGTGG + Intronic
1196828490 X:119758804-119758826 CTCCCGGGAGGCGGCGGCTGCGG - Exonic
1198099635 X:133413544-133413566 TCTCCGGGTGGGGCGGGCAGGGG - Intronic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1200827446 Y:7659133-7659155 GTTCAGGGAGGAGCCTGCAGTGG + Intergenic
1202305312 Y:23463454-23463476 TTTCCGGGAGGCAGAGGCTGCGG - Intergenic
1202565497 Y:26207135-26207157 TTTCCGGGAGGCAGAGGCTGCGG + Intergenic