ID: 969674627

View in Genome Browser
Species Human (GRCh38)
Location 4:8607992-8608014
Sequence GGAGGGTCCCAGCATCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969674627_969674646 27 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674646 4:8608042-8608064 GCTGGGGGAGGGCGCGGAGTTGG No data
969674627_969674640 12 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674640 4:8608027-8608049 ACCTTAGGACGACCTGCTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 63
969674627_969674643 16 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674643 4:8608031-8608053 TAGGACGACCTGCTGGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 150
969674627_969674644 21 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674644 4:8608036-8608058 CGACCTGCTGGGGGAGGGCGCGG 0: 1
1: 0
2: 4
3: 37
4: 342
969674627_969674638 10 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674638 4:8608025-8608047 TAACCTTAGGACGACCTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 39
969674627_969674630 -3 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674630 4:8608012-8608034 TCCCAACCCACCCTAACCTTAGG No data
969674627_969674642 15 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674642 4:8608030-8608052 TTAGGACGACCTGCTGGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 88
969674627_969674639 11 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674639 4:8608026-8608048 AACCTTAGGACGACCTGCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 52
969674627_969674637 9 Left 969674627 4:8607992-8608014 CCGTGATGATGCTGGGACCCTCC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 969674637 4:8608024-8608046 CTAACCTTAGGACGACCTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969674627 Original CRISPR GGAGGGTCCCAGCATCATCA CGG (reversed) Intronic
900341211 1:2190252-2190274 GGAGGGACCAAGCCTCACCACGG + Intronic
900631859 1:3640710-3640732 GGAGCATCTCAGCATCAGCAGGG + Intronic
901451838 1:9340623-9340645 GGAGGGTCCCCGCAGCACCTGGG + Intronic
902121305 1:14168266-14168288 GTAGGTTCCCAGCATTACCAAGG - Intergenic
903692884 1:25186656-25186678 GGACAGTCCCACCATCATCCAGG + Intergenic
903931495 1:26864843-26864865 GGCGGGTCACAGTTTCATCAAGG + Intergenic
904890179 1:33773796-33773818 AGAGGGGCCCAGAGTCATCAGGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
910906166 1:92181497-92181519 GGAGGGTCTCAGGATGATGATGG + Exonic
914225588 1:145717346-145717368 GGAGTGTCTCACCATCATCCTGG - Intergenic
915160825 1:153919339-153919361 GGAGTGTCCCAGGGTCATTAGGG - Intronic
915535581 1:156533559-156533581 AGAGGGACCCACGATCATCATGG - Intronic
918142919 1:181733482-181733504 GGGGGGTGTCAGCCTCATCAAGG - Exonic
922347413 1:224707926-224707948 AGAGGGTCTCAGCAGCACCAGGG - Intronic
923472365 1:234303411-234303433 AGTGGGTCCCAGCATCAACAGGG - Intronic
1063210789 10:3879347-3879369 GGAGCATCCCAGGATCATGACGG + Intergenic
1071601310 10:86959884-86959906 GGAGGGTCCCAGCAGGGCCAGGG + Intronic
1073492222 10:103860230-103860252 GGGGGTTGCCAGCATCATCTGGG + Intergenic
1074517180 10:114180963-114180985 GGAAGCCCCCAGCAACATCAGGG + Intronic
1076996121 11:298358-298380 GGAGGGCCCCAGGATCAGGATGG + Exonic
1077088670 11:767715-767737 GCAGGGGCACAGCCTCATCATGG + Exonic
1077658989 11:4049665-4049687 GAAGGCTTCCAGCAGCATCAGGG + Intronic
1080478829 11:32624287-32624309 GGAGTGTAACAGCATCATCTCGG - Intronic
1081582254 11:44360394-44360416 CAGGGGTCCCAGCATGATCAGGG - Intergenic
1083205597 11:61146942-61146964 GGAGGGGCCTAGAATCACCAGGG - Intronic
1083702282 11:64487368-64487390 GGAGGGTCCCAGAAGCAAGAAGG + Intergenic
1088915148 11:114221978-114222000 GGATGGTCACTGCATGATCATGG - Intronic
1089160288 11:116432140-116432162 GGAGGGTCCTGGCAGCAGCAGGG - Intergenic
1090016512 11:123091016-123091038 CGAGGGTCCCAGTATCTTCAAGG + Intronic
1090243880 11:125202257-125202279 GGAGGGTCCCAGCTGCAGCCTGG - Intronic
1095848317 12:46771927-46771949 GGAGGTCCCCAGCACCATCCAGG + Intronic
1096196844 12:49654081-49654103 GCAGGGTCCCAGGAGCATCAAGG + Intronic
1097455273 12:59792459-59792481 GGAGGGTCCCTTCCTCATCTGGG + Intergenic
1097564183 12:61247951-61247973 GGAGGGTCATAGAATCATTAAGG + Intergenic
1099709537 12:86204711-86204733 GTAGGGACCCACCATCATCCTGG - Intronic
1101178203 12:102179475-102179497 GCAGGGTGCCAGCATGGTCAGGG + Intronic
1102783140 12:115582916-115582938 GGAGTGTAGCAGCATGATCATGG - Intergenic
1103979697 12:124728424-124728446 GGAGGGTGGCAGCATGATCAAGG - Intergenic
1104981671 12:132575776-132575798 AGAGTACCCCAGCATCATCATGG + Intronic
1106593106 13:31114773-31114795 TGAGGGTCCCAGCATGGTTAGGG + Intergenic
1111949083 13:94695722-94695744 GGTGTGTACCAGAATCATCAGGG + Intergenic
1113483091 13:110635870-110635892 GGAGGGTGCCTGCAACAGCAGGG + Intronic
1113698133 13:112363243-112363265 GGAGGGTCACAGCAGGATCGTGG - Intergenic
1114146109 14:19980015-19980037 CGAGGGCCCCAGCATCAGCTGGG + Intergenic
1114205173 14:20564189-20564211 TGAGGGCCCCAGTATCTTCAAGG - Intergenic
1115882350 14:37933660-37933682 AGAGGGATCCAGCATTATCATGG - Intronic
1120116027 14:80618725-80618747 AGAGGGTCCCAGCTTCATATAGG - Intronic
1121946411 14:98126881-98126903 GGTGGCTCCCAGCATCAAGATGG - Intergenic
1122093464 14:99354660-99354682 GGATGGGCCCAGGAGCATCAAGG - Intergenic
1123037290 14:105476687-105476709 GGCGTGTCCCAGCAGCAGCAAGG - Intronic
1123723637 15:23081592-23081614 GGAAGATCCCAGCATCAGCGGGG - Intergenic
1124740622 15:32292623-32292645 GGAGGGTCCTAGGACCACCACGG + Intergenic
1125611913 15:40977112-40977134 GGAGGCACCCAGCTTCCTCAGGG + Intergenic
1127200181 15:56637484-56637506 GGATGGTCTCAACATCATTATGG - Intronic
1128982432 15:72197450-72197472 GGACGGTCCCGGCAGCATCGGGG - Intronic
1129159755 15:73740679-73740701 GGTGGGTCCCTGCATCAGCCAGG + Intronic
1129206949 15:74043039-74043061 GGAAGGCCCCAGCACCCTCAGGG + Exonic
1132331612 15:101015880-101015902 GGAGGGTGCCAGCACTGTCAGGG + Intronic
1134718663 16:16369288-16369310 GGATGGTCCCCACAGCATCACGG - Intergenic
1134956092 16:18382871-18382893 GGATGGTCCCCACAGCATCACGG + Intergenic
1137507805 16:49070052-49070074 GGAGTGCAGCAGCATCATCATGG + Intergenic
1138547001 16:57725854-57725876 GGAGGGGCCCAGCACCATATGGG + Intronic
1139587309 16:67912339-67912361 TTTGGTTCCCAGCATCATCATGG + Intronic
1140389997 16:74577662-74577684 GGAGGGTAGTGGCATCATCATGG + Intronic
1142006212 16:87690676-87690698 GGAGGGTCCCAGCGACCTGAGGG - Intronic
1142132663 16:88438012-88438034 GGTGGCTCCCAGCACCACCAAGG + Exonic
1142362028 16:89631906-89631928 GGGTGGTCCCTGCATCCTCATGG + Intronic
1147141954 17:38465133-38465155 CCAGGCTCCCGGCATCATCACGG - Intronic
1148050837 17:44769317-44769339 GGAGGGCCCCAGGAGTATCATGG - Intronic
1148232445 17:45944857-45944879 GGACTGTCGCAGCAGCATCACGG - Intronic
1148590374 17:48812048-48812070 GGGGGGTCCCAGCATCACCTGGG - Intronic
1149080633 17:52652242-52652264 GGAGGGCCTCAGTGTCATCATGG + Intergenic
1150210319 17:63438086-63438108 GGAGGGGCCCAGCCTCCCCACGG + Intronic
1153226151 18:2901543-2901565 GTAGGGTCACAGCCTCACCATGG - Intronic
1153813793 18:8775815-8775837 AGAGGGTCACAGAATCATCATGG - Intronic
1156984991 18:43340577-43340599 GGATGGTCCCAACACCAGCATGG - Intergenic
1157501626 18:48194651-48194673 GGACAGGCCCAGCATCACCAGGG + Intronic
1160012321 18:75115552-75115574 GCTGGGTCCCAGCAGCAACAGGG - Intergenic
1160402411 18:78620603-78620625 GGAGTGTCCCAGTGTCACCAGGG - Intergenic
1160910024 19:1469991-1470013 GGACGGTCCCAGCCTCGCCAAGG + Exonic
1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG + Intronic
1162163598 19:8737715-8737737 TGAGGGTGCCAGCATGATCAGGG - Intergenic
1162170950 19:8788361-8788383 TGAGGGTGCCAGCATGATCGGGG - Intergenic
1162171344 19:8791669-8791691 TGAGGGTGCCAGCATGATCGGGG + Intergenic
1163100888 19:15095723-15095745 GGAGGCTACCAGCATCATGAGGG - Intergenic
1163584741 19:18157484-18157506 GTTGGGTCCCAGCATCCCCAGGG - Intronic
1163615939 19:18328344-18328366 GAGGTGTCCCAGCATCAACATGG + Intergenic
1166539726 19:43597093-43597115 GAAGGGTCCCAGCACCATGGAGG + Exonic
1166650541 19:44571194-44571216 GGAGTGTGCCAGCTTGATCATGG + Intergenic
1167756165 19:51415083-51415105 GGAGGGGCCCAGCAGCTTCGGGG + Exonic
1168171504 19:54592936-54592958 AGAGGGTCCCAGGACCTTCAAGG - Intronic
1168382874 19:55939074-55939096 GGAGGGTCTCAAGATCATCAGGG - Intergenic
925021569 2:573756-573778 GGCAGTTCCCAGCATCATCTCGG + Intergenic
925079769 2:1054601-1054623 AGGGGGTCCCAGAATCACCAAGG - Intronic
925460369 2:4057808-4057830 TCAGTGTCCCAGCTTCATCAGGG - Intergenic
927653131 2:24924252-24924274 AGAGGGTCCCAGCAGGATCAAGG - Intergenic
932357490 2:71078381-71078403 GGAGTGCCTCAGCTTCATCAGGG - Exonic
932369947 2:71178646-71178668 GGAGTGCCTCAGCTTCATCAGGG - Intergenic
933398986 2:81767042-81767064 GTATGGACACAGCATCATCAAGG - Intergenic
933651134 2:84851161-84851183 GGAGGGTCCCAGCAAAATCCAGG + Intronic
934049033 2:88194816-88194838 AGAGGTTCTCAGCATCACCAAGG - Intergenic
936061805 2:109299551-109299573 GGAGTCACCAAGCATCATCATGG + Intronic
937919180 2:127118279-127118301 GAAGGGTCTCAGCACCAGCAGGG + Intergenic
942261833 2:174172583-174172605 AGAGGGTCCCTGCAGAATCATGG - Intronic
943318198 2:186414330-186414352 TCAGTGTCCCAGCTTCATCAGGG + Intergenic
1172213301 20:33216048-33216070 GGAGGGTCCCTGCATCCTCTTGG - Intergenic
1172399573 20:34638161-34638183 GGAGGGACACAGCATGTTCATGG - Intronic
1173788675 20:45813317-45813339 GGAGGCTCCCCACATCACCAAGG - Intronic
1173878790 20:46394960-46394982 GGAAGATCCCAGCATCAGCAGGG + Intronic
1174132439 20:48355530-48355552 GAAGGGTCCCAGCACAAGCAAGG + Intergenic
1175262178 20:57681508-57681530 GGGTGGTCCCAGCATCAAGAAGG + Intronic
1175901951 20:62363481-62363503 GGAGGCTCCCAGCAGAATCCTGG + Intronic
1176034480 20:63029517-63029539 GGGGGGTCCCCGCACCTTCACGG - Intergenic
1176096209 20:63345670-63345692 CGAGGGTCCCAGCATCTCCCAGG + Exonic
1179445154 21:41425835-41425857 GGATGATCCCAGCACCAGCAGGG - Intronic
1179828103 21:43979535-43979557 AGAGGGTCCCAGCATCATGTGGG - Intronic
1183831034 22:40418484-40418506 TCAGGGCCCCAGCCTCATCAAGG - Exonic
1184138916 22:42566221-42566243 GGAGGGTTCCAGCAAAGTCACGG + Intronic
1184776311 22:46625229-46625251 GGAGGTTCCCAGCATGGTGAGGG - Intronic
1185271635 22:49932150-49932172 GCAGGGGGCCAGAATCATCATGG + Intergenic
950329602 3:12145936-12145958 GGAGGGTCCCTACATCTTCCAGG + Intronic
954005611 3:47588186-47588208 GGAGGTTCCCTGCATCTTCCAGG + Exonic
958427340 3:93994221-93994243 GGAAGGTCCAAGAATCAGCAAGG - Intronic
961435904 3:126916532-126916554 GTGGGGTCCTAGCATCAGCAGGG - Intronic
962509725 3:136086078-136086100 GGAGTGTAGCAGCACCATCATGG - Intronic
962904758 3:139791581-139791603 GGAGGCTGCCACCATCATCTGGG + Intergenic
967854254 3:194104538-194104560 GGAGGGTCCCACCCTCCACAGGG - Intergenic
968498426 4:931918-931940 GGAGGGTCCCAGCGGGATCGTGG - Intronic
968601776 4:1513054-1513076 GGAGGGTCCCAGCACCGCCCAGG + Intergenic
968601784 4:1513075-1513097 GGAGGGTCCCAGCACCGCCCAGG + Intergenic
969674627 4:8607992-8608014 GGAGGGTCCCAGCATCATCACGG - Intronic
969866192 4:10078457-10078479 GAAGTTTCCCAGCATCTTCAAGG - Intronic
971552119 4:27970499-27970521 GGAGTGTCCCAGGAGCACCATGG - Intergenic
971979641 4:33735527-33735549 TCAGTGTCCCAGCTTCATCAGGG + Intergenic
977171032 4:93762894-93762916 GGAGGGCTACAGAATCATCAGGG + Intronic
980995668 4:139777575-139777597 GGAGTGCAGCAGCATCATCATGG + Intronic
982203028 4:152976597-152976619 GGAGGGTCCCAGTGCCAACACGG + Exonic
984931687 4:184853506-184853528 GGTGAGGCCCAGCATCCTCACGG + Intergenic
985859614 5:2460582-2460604 GGAGGGTCCCTGCATCTATAGGG - Intergenic
986301946 5:6484331-6484353 GGAGGGGCCCAGAATCCTCAGGG - Intronic
990988892 5:61665947-61665969 GGTGGGTCCCAGCATGACCTGGG + Intronic
992941266 5:81764662-81764684 GGGGAGTGCCAGCATCTTCAAGG - Intergenic
993034415 5:82741289-82741311 GGAAGGACCCTGCAGCATCATGG - Intergenic
995366081 5:111362732-111362754 AGAAGGTGCCAGCATCAGCATGG - Intronic
997327000 5:133029957-133029979 GGAGTGCCCCAGCATGATCTTGG + Intergenic
998776890 5:145613513-145613535 GGTGGTTTCCAGCTTCATCAAGG - Intronic
999779861 5:154840577-154840599 GGAGTGTAGCAGCATGATCATGG + Intronic
1002373121 5:178770177-178770199 GGAGGGGCCCAGCCTCCACAGGG - Intergenic
1008718439 6:54318523-54318545 GGAGGTTCCCAGAAGCATGAAGG - Intronic
1013089269 6:106884863-106884885 GGAAGGTCCCAGCTACATCCTGG + Intergenic
1013645376 6:112133519-112133541 GCAGGGTAACATCATCATCATGG - Intronic
1015551001 6:134412382-134412404 TGCAGGTCCCAGCATCATCTGGG - Intergenic
1017854732 6:158340407-158340429 GGAGGGCCCAAGCAGCGTCAGGG - Intronic
1023679758 7:42673633-42673655 TGAGGGTCCCAGCATCTTGCTGG + Intergenic
1030041330 7:105453048-105453070 GGAGGGTCCCAGGAGAATCTTGG + Intronic
1035275476 7:157745624-157745646 TGAGGGTGCCAGCATCTGCAGGG + Intronic
1035476257 7:159145597-159145619 GGTGGGTCCCAGCCTCAGCTGGG + Intergenic
1036805849 8:11832755-11832777 TGAGGATCACAGCATCATCCTGG - Intronic
1037177282 8:15962115-15962137 GGAGGGACCCACTCTCATCACGG - Intergenic
1038567733 8:28634034-28634056 GGACAGTCCCAGCATCCACATGG + Intronic
1039049941 8:33484140-33484162 GGAGGGCCACAGCATGATCTCGG + Intronic
1039615013 8:38948607-38948629 GTGGGGGCCCAGCATAATCAGGG + Intronic
1040310078 8:46232309-46232331 GGAGGTTCCCAGCATCCGCAAGG - Intergenic
1045801268 8:106104018-106104040 GGCGGGTCCCTGAATCTTCATGG + Intergenic
1046418003 8:113940495-113940517 TCAGTGTCCCAGCTTCATCAGGG + Intergenic
1048158699 8:131991089-131991111 GGAAGGTCTCACAATCATCATGG + Intronic
1048825125 8:138416931-138416953 GGAGTGGCCCAGTCTCATCATGG + Intronic
1049597187 8:143490141-143490163 GGAGGCTCCCACCTTCCTCATGG - Intronic
1049693248 8:143971917-143971939 AGAGGGTCCCAGCAACCTCCAGG + Intronic
1049783326 8:144438917-144438939 GCAGGGTCCCAGCAGGGTCAGGG - Intronic
1050187388 9:2988574-2988596 GGGTGGTCCCAGCATGAGCAGGG - Intergenic
1052348436 9:27433978-27434000 GGTGGAGCCCAGCATCATGAGGG + Intronic
1056581428 9:87889982-87890004 GGAGGGACCCAGCACCAGGACGG - Intergenic
1057296952 9:93851917-93851939 GGAGGCTGCCAGCATGATCTTGG + Intergenic
1057729054 9:97593253-97593275 GGGGGATACCAGCATCATCTAGG + Intronic
1059196716 9:112377297-112377319 GGAGTGTAGCAGCATGATCATGG - Intergenic
1060521923 9:124298863-124298885 GGCAGGGCCCAGCATGATCAGGG + Intronic
1061695199 9:132368282-132368304 TGAGGACCCCAGTATCATCAAGG + Intergenic
1061864088 9:133483538-133483560 GGATGGTCTCATCATCATCAGGG + Intergenic
1186052857 X:5617992-5618014 GGAGGGCAGCAGCATAATCATGG - Intergenic
1187382640 X:18818969-18818991 TGAGGGTCCAAGCATGATGATGG - Intronic
1195063131 X:101215980-101216002 AGAGGGAAGCAGCATCATCAGGG - Intergenic
1195335519 X:103849416-103849438 AGTGGGTATCAGCATCATCAAGG - Intergenic
1199947840 X:152681971-152681993 GGAGGGTCCCAGGCTCAGCCAGG + Intergenic
1199961839 X:152786483-152786505 GGAGGGTCCCAGGCTCAGCCAGG - Intergenic