ID: 969674770

View in Genome Browser
Species Human (GRCh38)
Location 4:8608494-8608516
Sequence ACCTGGGCCCCTCCCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969674758_969674770 28 Left 969674758 4:8608443-8608465 CCGAGCACATAGCTGGGCCCCTG 0: 1
1: 1
2: 1
3: 32
4: 314
Right 969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG No data
969674764_969674770 9 Left 969674764 4:8608462-8608484 CCTGGTTGGCACTCAGGTATCAG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG No data
969674762_969674770 11 Left 969674762 4:8608460-8608482 CCCCTGGTTGGCACTCAGGTATC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG No data
969674763_969674770 10 Left 969674763 4:8608461-8608483 CCCTGGTTGGCACTCAGGTATCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969674770 Original CRISPR ACCTGGGCCCCTCCCTGTCC TGG Intronic
No off target data available for this crispr