ID: 969675301

View in Genome Browser
Species Human (GRCh38)
Location 4:8611231-8611253
Sequence TGGTGGGTCAGGCAGGCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3667
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 3596}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969675301_969675310 3 Left 969675301 4:8611231-8611253 CCCTTCGCCTGCCTGACCCACCA 0: 1
1: 0
2: 3
3: 67
4: 3596
Right 969675310 4:8611257-8611279 GCCTCTGCCCAAGGTCAGTCTGG 0: 1
1: 0
2: 0
3: 17
4: 211
969675301_969675315 16 Left 969675301 4:8611231-8611253 CCCTTCGCCTGCCTGACCCACCA 0: 1
1: 0
2: 3
3: 67
4: 3596
Right 969675315 4:8611270-8611292 GTCAGTCTGGGACTTACAGACGG 0: 1
1: 0
2: 0
3: 7
4: 117
969675301_969675308 -6 Left 969675301 4:8611231-8611253 CCCTTCGCCTGCCTGACCCACCA 0: 1
1: 0
2: 3
3: 67
4: 3596
Right 969675308 4:8611248-8611270 CCACCAGGAGCCTCTGCCCAAGG 0: 1
1: 0
2: 5
3: 55
4: 426
969675301_969675312 4 Left 969675301 4:8611231-8611253 CCCTTCGCCTGCCTGACCCACCA 0: 1
1: 0
2: 3
3: 67
4: 3596
Right 969675312 4:8611258-8611280 CCTCTGCCCAAGGTCAGTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969675301 Original CRISPR TGGTGGGTCAGGCAGGCGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr