ID: 969676582

View in Genome Browser
Species Human (GRCh38)
Location 4:8617737-8617759
Sequence GTGGGGTCCAAGGATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969676582_969676592 16 Left 969676582 4:8617737-8617759 CCTTCAGCATCCTTGGACCCCAC 0: 1
1: 0
2: 3
3: 11
4: 188
Right 969676592 4:8617776-8617798 TAGAGCAGGGGCCGTGTGGGTGG No data
969676582_969676590 12 Left 969676582 4:8617737-8617759 CCTTCAGCATCCTTGGACCCCAC 0: 1
1: 0
2: 3
3: 11
4: 188
Right 969676590 4:8617772-8617794 TGACTAGAGCAGGGGCCGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 153
969676582_969676588 3 Left 969676582 4:8617737-8617759 CCTTCAGCATCCTTGGACCCCAC 0: 1
1: 0
2: 3
3: 11
4: 188
Right 969676588 4:8617763-8617785 GTTTTCTGCTGACTAGAGCAGGG No data
969676582_969676589 4 Left 969676582 4:8617737-8617759 CCTTCAGCATCCTTGGACCCCAC 0: 1
1: 0
2: 3
3: 11
4: 188
Right 969676589 4:8617764-8617786 TTTTCTGCTGACTAGAGCAGGGG No data
969676582_969676587 2 Left 969676582 4:8617737-8617759 CCTTCAGCATCCTTGGACCCCAC 0: 1
1: 0
2: 3
3: 11
4: 188
Right 969676587 4:8617762-8617784 TGTTTTCTGCTGACTAGAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 182
969676582_969676591 13 Left 969676582 4:8617737-8617759 CCTTCAGCATCCTTGGACCCCAC 0: 1
1: 0
2: 3
3: 11
4: 188
Right 969676591 4:8617773-8617795 GACTAGAGCAGGGGCCGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969676582 Original CRISPR GTGGGGTCCAAGGATGCTGA AGG (reversed) Intronic
900526081 1:3129515-3129537 GTGTCGTCCAGGGCTGCTGAGGG + Intronic
900802444 1:4745740-4745762 GTGGAGTCAAAGGAGGCTGCTGG + Intronic
901490792 1:9595335-9595357 GTGAGAGCCAAGGAGGCTGAGGG - Intronic
901828692 1:11879215-11879237 GTGGGCTCCACGGTGGCTGAAGG - Intergenic
902372963 1:16016985-16017007 CTGGGGTCCCAGGATGGTAAGGG + Intronic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
902552672 1:17228814-17228836 GGGGTGGCCAAGGAGGCTGAGGG + Intronic
902719773 1:18296186-18296208 AAGGGGTCCCAGGAAGCTGATGG - Intronic
902950280 1:19877331-19877353 GTGGGTGCAAAGGATGCGGAAGG - Intergenic
903670414 1:25032011-25032033 CTGGGGTGCAATGATCCTGAAGG + Intergenic
903951647 1:26999111-26999133 GGGTGGGCCAAGGATGCTCAGGG + Intronic
904806137 1:33133727-33133749 GTGTGGGCCAAGGCTGCTGAGGG - Intergenic
904846859 1:33426300-33426322 GTGGGGTTCAAAGCTGCTGGGGG + Intronic
904884217 1:33724368-33724390 ATGGGGTCCCAGGAGGATGACGG - Intronic
909687877 1:78371504-78371526 GAGAGGTCCAAGCATCCTGATGG - Intronic
910621283 1:89258125-89258147 GTGGGATCCAGGGAAGCTGGTGG + Intergenic
915555522 1:156658775-156658797 GTGGAGTCCAAGGCTACTGTTGG - Intronic
917539322 1:175897891-175897913 GAGGGGTCTCAGGGTGCTGAGGG + Intergenic
917711527 1:177689776-177689798 GTGGGGACAAAGGATGTTGTGGG - Intergenic
918304636 1:183234833-183234855 GTGGGGGCCAAGACTGCAGAGGG + Intronic
919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG + Intronic
922233075 1:223702900-223702922 GAGGGGTCCATGGAAGCAGAGGG + Intronic
924112183 1:240711205-240711227 GAGGGGTCAGAGGATGCTGGAGG - Intergenic
1063369704 10:5513107-5513129 GTGGGGGCAAAGGAAGGTGAGGG - Intergenic
1066076954 10:31888306-31888328 GTGGGGTCCAATCATGCTCCTGG + Intronic
1066317024 10:34258302-34258324 GTGCGGCCCATGGATACTGATGG - Intronic
1069703650 10:70443358-70443380 TTGGGTTCCAACGATGATGATGG - Intronic
1069800508 10:71078833-71078855 GTGGGGTTGGAGGTTGCTGAGGG - Intergenic
1070758009 10:79005473-79005495 GTGGGGTCCCAGGTGGCTGGAGG - Intergenic
1070830693 10:79416405-79416427 ATGTGGTCCAAGGCTGCTGGGGG + Intronic
1073054312 10:100689261-100689283 GGGGGGCACAGGGATGCTGAAGG + Intergenic
1077036186 11:495610-495632 GTGGGGGCCAGGGAAGCTGCAGG + Intronic
1077225349 11:1437006-1437028 GTGGGGTTAAGGGCTGCTGAGGG + Intronic
1079466401 11:20735176-20735198 GTCGGGTCAAATGCTGCTGAGGG + Intronic
1080641442 11:34160745-34160767 GGGGGGTCCCTGGGTGCTGAGGG + Intronic
1087177053 11:95105826-95105848 GTGGAATCCATGGATGCAGAAGG + Intronic
1088504741 11:110516779-110516801 GTGGTGGCCAAGGAAGCTGGAGG - Intergenic
1089606963 11:119647079-119647101 GTGTGGCCCATGGATGGTGATGG - Intronic
1091834958 12:3579256-3579278 CTGGGGTCCAAGAATATTGAAGG - Intronic
1091910216 12:4224540-4224562 GTGGAGTCCAATGATCCAGACGG + Intergenic
1095954550 12:47798704-47798726 CTGGTGTCTAGGGATGCTGAAGG + Intronic
1097372907 12:58805867-58805889 GTGGGGTCCCAGGAAACTTAAGG - Intronic
1097822779 12:64144716-64144738 ACGGTGTCCAAGGGTGCTGAAGG - Exonic
1099921931 12:88969266-88969288 TTCCGGTCCAAGGTTGCTGAAGG - Intergenic
1104472853 12:129044594-129044616 GTGTGGTCCAAGGAGGCAAAGGG + Intergenic
1106596855 13:31150269-31150291 GTGGGATCCAAGGTGTCTGAGGG - Intronic
1111072182 13:83183885-83183907 GCGGGGACCAGGGGTGCTGAAGG - Intergenic
1113583698 13:111448449-111448471 GTGTGATCCCAGGATGCTGGTGG - Intergenic
1114251652 14:20967041-20967063 GTGTGGCCCAAGAATGCTGGTGG - Intergenic
1118724777 14:68621311-68621333 GTGATGCCCAAGGGTGCTGATGG + Intronic
1118772826 14:68953345-68953367 GTGGGGGACATGGAGGCTGAGGG - Intronic
1119599112 14:75962895-75962917 GAAGGGTCCAAGGATGCTACTGG - Intronic
1122309461 14:100785371-100785393 GGGAGCTCCAAGGATGCGGAGGG - Intergenic
1124841273 15:33244376-33244398 CTGGGGTCCCAGGCTGCAGATGG + Intergenic
1126901456 15:53318860-53318882 GGGGGGACCAAGGAAGCTGCCGG + Intergenic
1128977397 15:72163651-72163673 GTGGAGTCCACGGATGATGGAGG + Exonic
1130225776 15:82057455-82057477 TTGTGGTGCAGGGATGCTGAGGG - Intergenic
1131787008 15:95924276-95924298 GTGGGCTACAAAGATGCTGTGGG - Intergenic
1135607443 16:23836439-23836461 GCGGGGTCCCAGGGTGCGGAGGG - Intronic
1136083963 16:27871210-27871232 GTGGAGGCCAGGGATGCTGCTGG + Intronic
1136371143 16:29836864-29836886 GTGGGGGCCCAGGGTGGTGATGG - Exonic
1138155658 16:54700760-54700782 GTGGTTTCAAAAGATGCTGATGG + Intergenic
1139312556 16:66039888-66039910 GTGGAGTCCATGGCTACTGAGGG - Intergenic
1141410262 16:83828360-83828382 GAGGGGTCCAGGGAGGCTCACGG - Intergenic
1143474200 17:7193547-7193569 GGTGGGCCCAAGGATGATGATGG + Exonic
1143652235 17:8270496-8270518 CTGGGGTCCACAGATGGTGAGGG + Intergenic
1145256078 17:21323228-21323250 GTGGGGTCCACGGCTGCGGGAGG + Intergenic
1145913682 17:28557636-28557658 GTGTGGCCCAAGGATTGTGAGGG - Intronic
1146787660 17:35732890-35732912 GTGGTGTCCAGGGATGCCTAAGG + Intronic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1150122690 17:62617154-62617176 GAGGGGTCCAGGGCTGCAGAAGG + Intergenic
1150445467 17:65224599-65224621 TTGGGGCCCAAGGATGGAGAAGG + Intronic
1151869029 17:76824098-76824120 GGTGGGTGGAAGGATGCTGAAGG - Intergenic
1152161164 17:78669510-78669532 GTGGGGTGGAGGGATCCTGAAGG - Intergenic
1152179004 17:78806216-78806238 GTGAGGTCGGAGGATGGTGAGGG + Exonic
1152473088 17:80501007-80501029 GTGATGACCAAGGGTGCTGAGGG - Intergenic
1152724309 17:81937530-81937552 GTGGGGTCCGAGGACGCGGGCGG + Intronic
1155035249 18:22020417-22020439 GTGGTGTCCAAGGTTGGTGGTGG - Intergenic
1157006648 18:43590546-43590568 GTGGGCTCCCAGGATGCACAGGG + Intergenic
1157942208 18:51941822-51941844 GTTTGGTCCAAAGATGGTGATGG + Intergenic
1159526038 18:69590731-69590753 GTGAGGACCATGGAGGCTGATGG + Intronic
1161308145 19:3578455-3578477 GTGGGGGCCAGAGATGATGAGGG + Intronic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1163072242 19:14853954-14853976 ATGGTGTCAGAGGATGCTGAGGG + Intergenic
1165061560 19:33207460-33207482 GTGGGGGCCCAGGGTGCTGCTGG - Exonic
1165472922 19:36013910-36013932 GGGGGATCCGAGGAGGCTGAGGG - Intronic
1165734152 19:38165080-38165102 CTGGGGTCCCTGAATGCTGATGG - Intronic
1165739482 19:38196770-38196792 GGGGGGAGCAAGGAGGCTGAGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
925205691 2:2003697-2003719 GTGGGGCCCATGGGTGCTTAGGG + Intronic
925860945 2:8174595-8174617 GTGGTCTCCACTGATGCTGAGGG - Intergenic
926061213 2:9806326-9806348 GTGGGCCCTAAGGAGGCTGAGGG - Intergenic
927890069 2:26742592-26742614 TTGGGGCTCCAGGATGCTGAGGG + Intergenic
928193305 2:29193828-29193850 GTGAGGCCCAAGGACCCTGAGGG - Exonic
929404951 2:41630837-41630859 GTGTGGTCCAAAGAGTCTGACGG + Intergenic
931795138 2:65701149-65701171 GTGAGGCCCAGAGATGCTGAGGG - Intergenic
933769685 2:85735112-85735134 GTGGGGGCCAGGCATGCTGGGGG - Intergenic
933778374 2:85785490-85785512 GTGGGGTCCAAGGAGGGCGAGGG - Intronic
936799171 2:116245343-116245365 ATGGGGTCCAATGATGCTTGGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
939364431 2:141214103-141214125 ATGGAGCCCAAAGATGCTGAAGG + Intronic
940608526 2:155960050-155960072 GTGGGGTTCAAGAATGCAGTGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941582539 2:167317358-167317380 GTGGGCTCCAAGTATGGAGAAGG + Intergenic
944116558 2:196193138-196193160 CTGAGGTCCAAGGATACAGAGGG + Intergenic
946019659 2:216632708-216632730 GTGGGGGCCCAGGGTGCTAAGGG + Intergenic
946427927 2:219609229-219609251 GTGGGGGCCCAGGAGGCTGTGGG + Intronic
949043788 2:241861032-241861054 GTGGGGTCCCAGGACCCTGTAGG - Intergenic
1168856605 20:1013413-1013435 GGGGAGGCCATGGATGCTGAGGG - Intergenic
1170994145 20:21335922-21335944 CTGGTGTCCAATCATGCTGAAGG - Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172042023 20:32052527-32052549 GAGGGGTCCCAGGAGGCGGAGGG + Intronic
1173445837 20:43117297-43117319 GTTGGATCCAAGGATTCTCATGG - Intronic
1174069122 20:47887695-47887717 GTGATGTCCAAGGATCCTGCAGG - Intergenic
1174517896 20:51107243-51107265 GTGGAGGCCAGGGATGCTGCTGG + Intergenic
1175572834 20:60037069-60037091 CTGGGCACCAGGGATGCTGAAGG + Intergenic
1175604288 20:60299534-60299556 GTGGGGTCGGAGGAAGCCGAGGG + Intergenic
1178198016 21:30370604-30370626 GTGGATTCCAAGGATACTGAGGG + Intronic
1180738530 22:18036692-18036714 GTAGGGTCCTAGGAGCCTGAAGG - Intergenic
1181920649 22:26317831-26317853 GCTGGGTCCAGGGCTGCTGAGGG - Intronic
1183082803 22:35467731-35467753 CTGGCATCCAGGGATGCTGAGGG - Intergenic
1183376884 22:37470667-37470689 GAGGGCTCCCATGATGCTGAGGG - Intronic
1184408191 22:44312057-44312079 CTGGGGACCAGGGAGGCTGAGGG - Intronic
1185161845 22:49234685-49234707 GTGGCGTCCTAGGATGCTCCAGG + Intergenic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
949327873 3:2887399-2887421 GTGGGGGGCAAGGGTGTTGACGG + Intronic
950613097 3:14138660-14138682 GTGGAGGCCAAGGAAGCAGATGG + Intronic
950896844 3:16460460-16460482 GTGTGGTCCAAGGAGTATGAGGG - Intronic
951065392 3:18258645-18258667 GTGTGGTCCATGGATGATGCCGG + Intronic
952638068 3:35555836-35555858 GTGGAATCCAAGGCAGCTGATGG + Intergenic
952969691 3:38643179-38643201 GTGGGGTACAAGGAGGCTGAGGG - Intronic
961567346 3:127773189-127773211 GAGGGGCCCAAGAATGCTGTGGG + Intronic
962422513 3:135240874-135240896 GTGGGTTCCAATGTTGCTGCAGG - Intronic
964376702 3:156055105-156055127 GCTGGGGCCAAGGTTGCTGATGG - Intronic
965191583 3:165537307-165537329 GTGCGGTCGAAGGAAGATGATGG + Intergenic
965922636 3:173937081-173937103 GTGGGATCAGAGGAAGCTGAGGG - Intronic
968904678 4:3445774-3445796 GTGGGGTTCCGGGCTGCTGAGGG + Intronic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
969842602 4:9893419-9893441 GTGAGGTTCAAGAATACTGAGGG + Intronic
973195373 4:47433684-47433706 GTGGGGTCCAAGACTGAGGAGGG - Intergenic
978255569 4:106688819-106688841 GTGGGGCTCAAGGAAGCTGTTGG + Intergenic
981011854 4:139933308-139933330 GTTGGCTCTAAGGATGCTCATGG - Intronic
985551119 5:534147-534169 GTGGGGTCCAGGGACTGTGAAGG - Intergenic
985863794 5:2495596-2495618 GTGGGATCTGAGGATGCTGTGGG + Intergenic
985912078 5:2892585-2892607 GTGGGGCCCAAGGATGCTGTAGG - Intergenic
985969885 5:3366477-3366499 GTGGTGTCCATGTATGGTGATGG - Intergenic
986335505 5:6752252-6752274 GTGAAGTCCAGGGACGCTGAGGG + Intronic
986736890 5:10674654-10674676 CTGGGGTCCAGAGACGCTGATGG + Intergenic
986769247 5:10956926-10956948 GTGGGGTGCACGAATGCTGAGGG + Intergenic
996765006 5:127027502-127027524 GTGGGGTCCTGGGATGCTCTGGG - Intronic
997025425 5:130054947-130054969 GTGGGGTCTGAGGATGGTGGTGG + Intronic
1003147047 6:3517397-3517419 GTGGAATTCATGGATGCTGAGGG + Intergenic
1005752218 6:28894178-28894200 TTGGAGTCCAAGTATGCAGAGGG + Intergenic
1006638805 6:35478353-35478375 GTGGGGTTCATGGATGCTGAGGG - Intronic
1007757023 6:44106318-44106340 GTAGAGTCCAGGGATGCTGCTGG - Intergenic
1013224590 6:108111544-108111566 GTGTGATTCAAGGATGCTGTTGG - Intronic
1015717150 6:136204733-136204755 GTGTGGTCCAAGGCTGTGGAAGG + Intergenic
1016918287 6:149265538-149265560 GTGGGGGCCAAGGAAGCTTAAGG - Intronic
1021395298 7:20140062-20140084 GAGAGGTCCCAAGATGCTGAAGG + Exonic
1023965320 7:44960989-44961011 GAGGGGCTCAAGGAGGCTGAGGG + Intergenic
1024532499 7:50405516-50405538 GTGGGAGCCTAGGATGCTGAGGG - Intergenic
1025255181 7:57379878-57379900 GTGTGGTCCAAGGATCCCTAGGG + Intergenic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1029627526 7:101729658-101729680 GTGGTGCCCAAGGATCCTGCTGG + Intergenic
1030757193 7:113301349-113301371 GTGGTTTCCAAGCATGCAGAGGG - Intergenic
1030768567 7:113442991-113443013 GTGGGGTCCAAGGCTGTTAAGGG - Intergenic
1032319196 7:130869329-130869351 GTGGGGTCTGAAAATGCTGAGGG + Intergenic
1032761509 7:134947530-134947552 GTGGACACCAAGGAGGCTGAGGG + Exonic
1033088190 7:138361603-138361625 GTGGGGTGAAAGGATGGAGATGG - Intergenic
1035620159 8:1030465-1030487 GTGGGGTGCAAAGGTGCTCACGG + Intergenic
1036776340 8:11615427-11615449 GTGCAGACCAAAGATGCTGAGGG - Intergenic
1039432164 8:37533455-37533477 GTGGGGATTAAGGATGCAGATGG - Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041939330 8:63369498-63369520 ATGGGGACCAAGGATTTTGAGGG - Intergenic
1046895207 8:119464131-119464153 GTGGGGTGCATGCATGCTGAAGG - Intergenic
1048810818 8:138284440-138284462 GTGGAGTGGAAAGATGCTGAAGG - Intronic
1048876166 8:138838248-138838270 GTGGGGTCCCTGGAGGCTCATGG + Intronic
1049118979 8:140717042-140717064 GTAAGGTCTAAGGATGCTGCCGG + Intronic
1049587870 8:143440337-143440359 GTGGGGCGCTGGGATGCTGAAGG + Exonic
1050099138 9:2099859-2099881 GAGGGGTCAATGGATGCTGTTGG - Intronic
1052879662 9:33593592-33593614 GTGGGGTCGAAAGATGAGGATGG + Intergenic
1053022346 9:34703582-34703604 GTGTGGCCCAAGTATCCTGAAGG + Intergenic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1053496319 9:38550639-38550661 GTGGGGTCAAAAGATGAGGATGG - Intronic
1054996868 9:71401287-71401309 GTGGGGTGGAAGGAAGATGAGGG + Intronic
1055502335 9:76913846-76913868 GTGAGGTTCAAGAATGATGAGGG - Intergenic
1061057893 9:128233861-128233883 CTAGGGTCCCAGGACGCTGATGG - Intronic
1061188730 9:129069910-129069932 CTTGGGTCCAAGGAAGCCGAAGG - Exonic
1061789085 9:133049119-133049141 CAGGGGTCGAAGGGTGCTGATGG - Intronic
1062036349 9:134384304-134384326 TTGGGGTTCAAAGATGATGAGGG - Intronic
1062564066 9:137156222-137156244 ATGGGGTCCCAGGATGGTAATGG - Intronic
1186090578 X:6043550-6043572 GTGTGGGACAAGGATTCTGAAGG + Intronic
1186431629 X:9510154-9510176 GTAGAGGCCAAGGATGCTGCTGG + Intronic
1187698904 X:21946197-21946219 CTGGGGTCCATGGATGCCCAAGG - Intronic
1191608541 X:63086905-63086927 TTGAGGTGCAAGGATGCTGGGGG - Intergenic
1197989211 X:132299024-132299046 GTGGAGCCCATGGATGCAGAGGG - Intergenic
1198316762 X:135475526-135475548 GTGGAGTCAGAGGATGATGATGG + Intergenic
1200167251 X:154045327-154045349 GTGGGGACCCAGGGTGCTGCTGG - Intronic