ID: 969682241

View in Genome Browser
Species Human (GRCh38)
Location 4:8649781-8649803
Sequence CTGTGGGGCAGGCGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969682241_969682254 8 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682254 4:8649812-8649834 CCCCACCTGCCGCAGTTCCAGGG No data
969682241_969682260 13 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682260 4:8649817-8649839 CCTGCCGCAGTTCCAGGGAGGGG No data
969682241_969682257 11 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682257 4:8649815-8649837 CACCTGCCGCAGTTCCAGGGAGG No data
969682241_969682258 12 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682258 4:8649816-8649838 ACCTGCCGCAGTTCCAGGGAGGG No data
969682241_969682252 7 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682252 4:8649811-8649833 CCCCCACCTGCCGCAGTTCCAGG No data
969682241_969682263 17 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682263 4:8649821-8649843 CCGCAGTTCCAGGGAGGGGAGGG No data
969682241_969682261 16 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682261 4:8649820-8649842 GCCGCAGTTCCAGGGAGGGGAGG No data
969682241_969682265 30 Left 969682241 4:8649781-8649803 CCCGCTGCCCGCCTGCCCCACAG No data
Right 969682265 4:8649834-8649856 GAGGGGAGGGCTGATCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969682241 Original CRISPR CTGTGGGGCAGGCGGGCAGC GGG (reversed) Intergenic
No off target data available for this crispr