ID: 969684826

View in Genome Browser
Species Human (GRCh38)
Location 4:8665578-8665600
Sequence GGCTCTGGGGCAGAGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684826_969684837 24 Left 969684826 4:8665578-8665600 CCAGATCCCTCTGCCCCAGAGCC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684826_969684832 -5 Left 969684826 4:8665578-8665600 CCAGATCCCTCTGCCCCAGAGCC No data
Right 969684832 4:8665596-8665618 GAGCCTCTGCTCTGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684826 Original CRISPR GGCTCTGGGGCAGAGGGATC TGG (reversed) Intergenic
No off target data available for this crispr