ID: 969684827

View in Genome Browser
Species Human (GRCh38)
Location 4:8665584-8665606
Sequence AGCAGAGGCTCTGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684827_969684837 18 Left 969684827 4:8665584-8665606 CCCTCTGCCCCAGAGCCTCTGCT No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684827 Original CRISPR AGCAGAGGCTCTGGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr