ID: 969684828

View in Genome Browser
Species Human (GRCh38)
Location 4:8665585-8665607
Sequence GAGCAGAGGCTCTGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684828_969684837 17 Left 969684828 4:8665585-8665607 CCTCTGCCCCAGAGCCTCTGCTC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684828 Original CRISPR GAGCAGAGGCTCTGGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr