ID: 969684829

View in Genome Browser
Species Human (GRCh38)
Location 4:8665591-8665613
Sequence CAGGCAGAGCAGAGGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684829_969684837 11 Left 969684829 4:8665591-8665613 CCCCAGAGCCTCTGCTCTGCCTG No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684829_969684841 30 Left 969684829 4:8665591-8665613 CCCCAGAGCCTCTGCTCTGCCTG No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684829 Original CRISPR CAGGCAGAGCAGAGGCTCTG GGG (reversed) Intergenic
No off target data available for this crispr