ID: 969684830

View in Genome Browser
Species Human (GRCh38)
Location 4:8665592-8665614
Sequence GCAGGCAGAGCAGAGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684830_969684841 29 Left 969684830 4:8665592-8665614 CCCAGAGCCTCTGCTCTGCCTGC No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684830_969684837 10 Left 969684830 4:8665592-8665614 CCCAGAGCCTCTGCTCTGCCTGC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684830 Original CRISPR GCAGGCAGAGCAGAGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr