ID: 969684831

View in Genome Browser
Species Human (GRCh38)
Location 4:8665593-8665615
Sequence GGCAGGCAGAGCAGAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684831_969684837 9 Left 969684831 4:8665593-8665615 CCAGAGCCTCTGCTCTGCCTGCC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684831_969684841 28 Left 969684831 4:8665593-8665615 CCAGAGCCTCTGCTCTGCCTGCC No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684831 Original CRISPR GGCAGGCAGAGCAGAGGCTC TGG (reversed) Intergenic
No off target data available for this crispr