ID: 969684832

View in Genome Browser
Species Human (GRCh38)
Location 4:8665596-8665618
Sequence GAGCCTCTGCTCTGCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684826_969684832 -5 Left 969684826 4:8665578-8665600 CCAGATCCCTCTGCCCCAGAGCC No data
Right 969684832 4:8665596-8665618 GAGCCTCTGCTCTGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684832 Original CRISPR GAGCCTCTGCTCTGCCTGCC TGG Intergenic
No off target data available for this crispr