ID: 969684834

View in Genome Browser
Species Human (GRCh38)
Location 4:8665610-8665632
Sequence ATACAGAGGCACAGCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684834_969684837 -8 Left 969684834 4:8665610-8665632 CCTGCCTGGCTGTGCCTCTGTAT No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684834_969684844 29 Left 969684834 4:8665610-8665632 CCTGCCTGGCTGTGCCTCTGTAT No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data
969684834_969684841 11 Left 969684834 4:8665610-8665632 CCTGCCTGGCTGTGCCTCTGTAT No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684834 Original CRISPR ATACAGAGGCACAGCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr