ID: 969684837

View in Genome Browser
Species Human (GRCh38)
Location 4:8665625-8665647
Sequence CTCTGTATCCAGATGAAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684827_969684837 18 Left 969684827 4:8665584-8665606 CCCTCTGCCCCAGAGCCTCTGCT No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684826_969684837 24 Left 969684826 4:8665578-8665600 CCAGATCCCTCTGCCCCAGAGCC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684828_969684837 17 Left 969684828 4:8665585-8665607 CCTCTGCCCCAGAGCCTCTGCTC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684834_969684837 -8 Left 969684834 4:8665610-8665632 CCTGCCTGGCTGTGCCTCTGTAT No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684829_969684837 11 Left 969684829 4:8665591-8665613 CCCCAGAGCCTCTGCTCTGCCTG No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684830_969684837 10 Left 969684830 4:8665592-8665614 CCCAGAGCCTCTGCTCTGCCTGC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684831_969684837 9 Left 969684831 4:8665593-8665615 CCAGAGCCTCTGCTCTGCCTGCC No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data
969684833_969684837 3 Left 969684833 4:8665599-8665621 CCTCTGCTCTGCCTGCCTGGCTG No data
Right 969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684837 Original CRISPR CTCTGTATCCAGATGAAGCC CGG Intergenic
No off target data available for this crispr