ID: 969684841

View in Genome Browser
Species Human (GRCh38)
Location 4:8665644-8665666
Sequence CCGGTGCTGACCTGCTCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684829_969684841 30 Left 969684829 4:8665591-8665613 CCCCAGAGCCTCTGCTCTGCCTG No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684831_969684841 28 Left 969684831 4:8665593-8665615 CCAGAGCCTCTGCTCTGCCTGCC No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684836_969684841 -3 Left 969684836 4:8665624-8665646 CCTCTGTATCCAGATGAAGCCCG No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684835_969684841 7 Left 969684835 4:8665614-8665636 CCTGGCTGTGCCTCTGTATCCAG No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684833_969684841 22 Left 969684833 4:8665599-8665621 CCTCTGCTCTGCCTGCCTGGCTG No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684834_969684841 11 Left 969684834 4:8665610-8665632 CCTGCCTGGCTGTGCCTCTGTAT No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
969684830_969684841 29 Left 969684830 4:8665592-8665614 CCCAGAGCCTCTGCTCTGCCTGC No data
Right 969684841 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684841 Original CRISPR CCGGTGCTGACCTGCTCCTT CGG Intergenic
No off target data available for this crispr