ID: 969684844

View in Genome Browser
Species Human (GRCh38)
Location 4:8665662-8665684
Sequence TTCGGCTCCGCTGATCCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969684838_969684844 6 Left 969684838 4:8665633-8665655 CCAGATGAAGCCCGGTGCTGACC No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data
969684836_969684844 15 Left 969684836 4:8665624-8665646 CCTCTGTATCCAGATGAAGCCCG No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data
969684834_969684844 29 Left 969684834 4:8665610-8665632 CCTGCCTGGCTGTGCCTCTGTAT No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data
969684840_969684844 -5 Left 969684840 4:8665644-8665666 CCGGTGCTGACCTGCTCCTTCGG No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data
969684839_969684844 -4 Left 969684839 4:8665643-8665665 CCCGGTGCTGACCTGCTCCTTCG No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data
969684835_969684844 25 Left 969684835 4:8665614-8665636 CCTGGCTGTGCCTCTGTATCCAG No data
Right 969684844 4:8665662-8665684 TTCGGCTCCGCTGATCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969684844 Original CRISPR TTCGGCTCCGCTGATCCAGT CGG Intergenic
No off target data available for this crispr