ID: 969685988

View in Genome Browser
Species Human (GRCh38)
Location 4:8674598-8674620
Sequence CGGTGTGGCCGGGGAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969685988_969685997 10 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969685997 4:8674631-8674653 CACAGCTCATGCTGGAGAGATGG No data
969685988_969686000 15 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969686000 4:8674636-8674658 CTCATGCTGGAGAGATGGGAGGG No data
969685988_969686002 21 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685988_969685998 11 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969685998 4:8674632-8674654 ACAGCTCATGCTGGAGAGATGGG No data
969685988_969685996 2 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685988_969686001 18 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685988_969685999 14 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969685999 4:8674635-8674657 GCTCATGCTGGAGAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969685988 Original CRISPR CGGTGTGGCCGGGGAGGTGG TGG (reversed) Intergenic
No off target data available for this crispr