ID: 969685996

View in Genome Browser
Species Human (GRCh38)
Location 4:8674623-8674645
Sequence GACACTCACACAGCTCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969685992_969685996 -8 Left 969685992 4:8674608-8674630 CCCGGCCACACCGCAGACACTCA No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685991_969685996 -7 Left 969685991 4:8674607-8674629 CCCCGGCCACACCGCAGACACTC No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685989_969685996 -1 Left 969685989 4:8674601-8674623 CCACCTCCCCGGCCACACCGCAG No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685985_969685996 9 Left 969685985 4:8674591-8674613 CCCAGACCCACCACCTCCCCGGC No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685990_969685996 -4 Left 969685990 4:8674604-8674626 CCTCCCCGGCCACACCGCAGACA No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685993_969685996 -9 Left 969685993 4:8674609-8674631 CCGGCCACACCGCAGACACTCAC No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685983_969685996 10 Left 969685983 4:8674590-8674612 CCCCAGACCCACCACCTCCCCGG No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685987_969685996 3 Left 969685987 4:8674597-8674619 CCCACCACCTCCCCGGCCACACC No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685986_969685996 8 Left 969685986 4:8674592-8674614 CCAGACCCACCACCTCCCCGGCC No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data
969685988_969685996 2 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969685996 4:8674623-8674645 GACACTCACACAGCTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969685996 Original CRISPR GACACTCACACAGCTCATGC TGG Intergenic
No off target data available for this crispr