ID: 969686001

View in Genome Browser
Species Human (GRCh38)
Location 4:8674639-8674661
Sequence ATGCTGGAGAGATGGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969685995_969686001 -2 Left 969685995 4:8674618-8674640 CCGCAGACACTCACACAGCTCAT No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685987_969686001 19 Left 969685987 4:8674597-8674619 CCCACCACCTCCCCGGCCACACC No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685994_969686001 3 Left 969685994 4:8674613-8674635 CCACACCGCAGACACTCACACAG No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685991_969686001 9 Left 969685991 4:8674607-8674629 CCCCGGCCACACCGCAGACACTC No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685983_969686001 26 Left 969685983 4:8674590-8674612 CCCCAGACCCACCACCTCCCCGG No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685989_969686001 15 Left 969685989 4:8674601-8674623 CCACCTCCCCGGCCACACCGCAG No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685986_969686001 24 Left 969685986 4:8674592-8674614 CCAGACCCACCACCTCCCCGGCC No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685993_969686001 7 Left 969685993 4:8674609-8674631 CCGGCCACACCGCAGACACTCAC No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685992_969686001 8 Left 969685992 4:8674608-8674630 CCCGGCCACACCGCAGACACTCA No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685988_969686001 18 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685985_969686001 25 Left 969685985 4:8674591-8674613 CCCAGACCCACCACCTCCCCGGC No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data
969685990_969686001 12 Left 969685990 4:8674604-8674626 CCTCCCCGGCCACACCGCAGACA No data
Right 969686001 4:8674639-8674661 ATGCTGGAGAGATGGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969686001 Original CRISPR ATGCTGGAGAGATGGGAGGG CGG Intergenic
No off target data available for this crispr