ID: 969686002

View in Genome Browser
Species Human (GRCh38)
Location 4:8674642-8674664
Sequence CTGGAGAGATGGGAGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969685983_969686002 29 Left 969685983 4:8674590-8674612 CCCCAGACCCACCACCTCCCCGG No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685985_969686002 28 Left 969685985 4:8674591-8674613 CCCAGACCCACCACCTCCCCGGC No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685991_969686002 12 Left 969685991 4:8674607-8674629 CCCCGGCCACACCGCAGACACTC No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685993_969686002 10 Left 969685993 4:8674609-8674631 CCGGCCACACCGCAGACACTCAC No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685992_969686002 11 Left 969685992 4:8674608-8674630 CCCGGCCACACCGCAGACACTCA No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685988_969686002 21 Left 969685988 4:8674598-8674620 CCACCACCTCCCCGGCCACACCG No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685987_969686002 22 Left 969685987 4:8674597-8674619 CCCACCACCTCCCCGGCCACACC No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685990_969686002 15 Left 969685990 4:8674604-8674626 CCTCCCCGGCCACACCGCAGACA No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685989_969686002 18 Left 969685989 4:8674601-8674623 CCACCTCCCCGGCCACACCGCAG No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685986_969686002 27 Left 969685986 4:8674592-8674614 CCAGACCCACCACCTCCCCGGCC No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685995_969686002 1 Left 969685995 4:8674618-8674640 CCGCAGACACTCACACAGCTCAT No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data
969685994_969686002 6 Left 969685994 4:8674613-8674635 CCACACCGCAGACACTCACACAG No data
Right 969686002 4:8674642-8674664 CTGGAGAGATGGGAGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969686002 Original CRISPR CTGGAGAGATGGGAGGGCGG AGG Intergenic
No off target data available for this crispr