ID: 969689714

View in Genome Browser
Species Human (GRCh38)
Location 4:8697855-8697877
Sequence CAGGAGCAGGAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969689714_969689730 26 Left 969689714 4:8697855-8697877 CCTTCCTGCTTCTCCTGCTCCTG No data
Right 969689730 4:8697904-8697926 TGAGGCACTTGCCACGGAGCAGG No data
969689714_969689720 -3 Left 969689714 4:8697855-8697877 CCTTCCTGCTTCTCCTGCTCCTG No data
Right 969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG No data
969689714_969689725 8 Left 969689714 4:8697855-8697877 CCTTCCTGCTTCTCCTGCTCCTG No data
Right 969689725 4:8697886-8697908 CCACTGCCCTGGCCTCTGTGAGG No data
969689714_969689729 20 Left 969689714 4:8697855-8697877 CCTTCCTGCTTCTCCTGCTCCTG No data
Right 969689729 4:8697898-8697920 CCTCTGTGAGGCACTTGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969689714 Original CRISPR CAGGAGCAGGAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr