ID: 969689720

View in Genome Browser
Species Human (GRCh38)
Location 4:8697875-8697897
Sequence CTGGGTCCCCACCACTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969689714_969689720 -3 Left 969689714 4:8697855-8697877 CCTTCCTGCTTCTCCTGCTCCTG No data
Right 969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG No data
969689717_969689720 -7 Left 969689717 4:8697859-8697881 CCTGCTTCTCCTGCTCCTGGGTC No data
Right 969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG No data
969689713_969689720 2 Left 969689713 4:8697850-8697872 CCAGTCCTTCCTGCTTCTCCTGC No data
Right 969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969689720 Original CRISPR CTGGGTCCCCACCACTGCCC TGG Intergenic
No off target data available for this crispr