ID: 969691261

View in Genome Browser
Species Human (GRCh38)
Location 4:8705407-8705429
Sequence GCCTGGGGAGAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969691247_969691261 5 Left 969691247 4:8705379-8705401 CCTGGGGCTCAGGGCCCACCCCA No data
Right 969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG No data
969691245_969691261 14 Left 969691245 4:8705370-8705392 CCAGGCTGGCCTGGGGCTCAGGG No data
Right 969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG No data
969691254_969691261 -9 Left 969691254 4:8705393-8705415 CCCACCCCAGGGTGGCCTGGGGA No data
Right 969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG No data
969691255_969691261 -10 Left 969691255 4:8705394-8705416 CCACCCCAGGGTGGCCTGGGGAG No data
Right 969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969691261 Original CRISPR GCCTGGGGAGAGAGGGAAGC TGG Intergenic
No off target data available for this crispr