ID: 969694633

View in Genome Browser
Species Human (GRCh38)
Location 4:8727725-8727747
Sequence CTGGGCTGCCGGGCAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969694623_969694633 3 Left 969694623 4:8727699-8727721 CCCTGACTGTGACTCTTCCTGCC No data
Right 969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG No data
969694624_969694633 2 Left 969694624 4:8727700-8727722 CCTGACTGTGACTCTTCCTGCCA No data
Right 969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG No data
969694620_969694633 30 Left 969694620 4:8727672-8727694 CCGAGCTGCTTCCTGGAGGTTCT No data
Right 969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG No data
969694622_969694633 19 Left 969694622 4:8727683-8727705 CCTGGAGGTTCTGAGGCCCTGAC No data
Right 969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969694633 Original CRISPR CTGGGCTGCCGGGCAGACAC TGG Intergenic
No off target data available for this crispr