ID: 969695680

View in Genome Browser
Species Human (GRCh38)
Location 4:8732955-8732977
Sequence GGGCACCCATGGGGTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969695680_969695690 20 Left 969695680 4:8732955-8732977 CCTCTAGGACCCCATGGGTGCCC No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695680_969695691 21 Left 969695680 4:8732955-8732977 CCTCTAGGACCCCATGGGTGCCC No data
Right 969695691 4:8732999-8733021 GATCTCCCTTGAGTAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969695680 Original CRISPR GGGCACCCATGGGGTCCTAG AGG (reversed) Intergenic