ID: 969695690

View in Genome Browser
Species Human (GRCh38)
Location 4:8732998-8733020
Sequence AGATCTCCCTTGAGTAGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969695684_969695690 0 Left 969695684 4:8732975-8732997 CCCAGCACCTCAGTTTACCCCAG No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695685_969695690 -1 Left 969695685 4:8732976-8732998 CCAGCACCTCAGTTTACCCCAGA No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695682_969695690 10 Left 969695682 4:8732965-8732987 CCCATGGGTGCCCAGCACCTCAG No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695680_969695690 20 Left 969695680 4:8732955-8732977 CCTCTAGGACCCCATGGGTGCCC No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695683_969695690 9 Left 969695683 4:8732966-8732988 CCATGGGTGCCCAGCACCTCAGT No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695681_969695690 11 Left 969695681 4:8732964-8732986 CCCCATGGGTGCCCAGCACCTCA No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data
969695686_969695690 -7 Left 969695686 4:8732982-8733004 CCTCAGTTTACCCCAGAGATCTC No data
Right 969695690 4:8732998-8733020 AGATCTCCCTTGAGTAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969695690 Original CRISPR AGATCTCCCTTGAGTAGTTT TGG Intergenic