ID: 969699936

View in Genome Browser
Species Human (GRCh38)
Location 4:8762416-8762438
Sequence GTCTGTGGCTGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969699936_969699952 13 Left 969699936 4:8762416-8762438 CCCTCTGCCCTCCAGCCACAGAC No data
Right 969699952 4:8762452-8762474 GCCTTTCATCAGCAGGCCCAGGG No data
969699936_969699956 28 Left 969699936 4:8762416-8762438 CCCTCTGCCCTCCAGCCACAGAC No data
Right 969699956 4:8762467-8762489 GCCCAGGGGCTGGCACTGCCTGG No data
969699936_969699955 18 Left 969699936 4:8762416-8762438 CCCTCTGCCCTCCAGCCACAGAC No data
Right 969699955 4:8762457-8762479 TCATCAGCAGGCCCAGGGGCTGG No data
969699936_969699954 14 Left 969699936 4:8762416-8762438 CCCTCTGCCCTCCAGCCACAGAC No data
Right 969699954 4:8762453-8762475 CCTTTCATCAGCAGGCCCAGGGG No data
969699936_969699949 6 Left 969699936 4:8762416-8762438 CCCTCTGCCCTCCAGCCACAGAC No data
Right 969699949 4:8762445-8762467 GGATGCCGCCTTTCATCAGCAGG No data
969699936_969699951 12 Left 969699936 4:8762416-8762438 CCCTCTGCCCTCCAGCCACAGAC No data
Right 969699951 4:8762451-8762473 CGCCTTTCATCAGCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969699936 Original CRISPR GTCTGTGGCTGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr