ID: 969700305

View in Genome Browser
Species Human (GRCh38)
Location 4:8764290-8764312
Sequence CAGGTTGGCAAACTTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969700298_969700305 20 Left 969700298 4:8764247-8764269 CCTGTGTGTGATGGGGGCTCATA No data
Right 969700305 4:8764290-8764312 CAGGTTGGCAAACTTGTTGCTGG No data
969700302_969700305 -6 Left 969700302 4:8764273-8764295 CCACGTTCCGCTGAGGGCAGGTT No data
Right 969700305 4:8764290-8764312 CAGGTTGGCAAACTTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969700305 Original CRISPR CAGGTTGGCAAACTTGTTGC TGG Intergenic
No off target data available for this crispr