ID: 969701659

View in Genome Browser
Species Human (GRCh38)
Location 4:8770997-8771019
Sequence CCTTCTATGCAACAACTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969701652_969701659 13 Left 969701652 4:8770961-8770983 CCGTGCTCAGATGAGGAAACTGA No data
Right 969701659 4:8770997-8771019 CCTTCTATGCAACAACTGAAGGG No data
969701651_969701659 16 Left 969701651 4:8770958-8770980 CCTCCGTGCTCAGATGAGGAAAC No data
Right 969701659 4:8770997-8771019 CCTTCTATGCAACAACTGAAGGG No data
969701650_969701659 17 Left 969701650 4:8770957-8770979 CCCTCCGTGCTCAGATGAGGAAA No data
Right 969701659 4:8770997-8771019 CCTTCTATGCAACAACTGAAGGG No data
969701649_969701659 18 Left 969701649 4:8770956-8770978 CCCCTCCGTGCTCAGATGAGGAA No data
Right 969701659 4:8770997-8771019 CCTTCTATGCAACAACTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969701659 Original CRISPR CCTTCTATGCAACAACTGAA GGG Intergenic
No off target data available for this crispr