ID: 969704297

View in Genome Browser
Species Human (GRCh38)
Location 4:8783681-8783703
Sequence GTGTCACATTGCCAGCTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969704295_969704297 3 Left 969704295 4:8783655-8783677 CCAGCTCTTTAATTCTCTGTCCA No data
Right 969704297 4:8783681-8783703 GTGTCACATTGCCAGCTGACCGG No data
969704293_969704297 5 Left 969704293 4:8783653-8783675 CCCCAGCTCTTTAATTCTCTGTC No data
Right 969704297 4:8783681-8783703 GTGTCACATTGCCAGCTGACCGG No data
969704292_969704297 20 Left 969704292 4:8783638-8783660 CCAGATTAATATGCACCCCAGCT No data
Right 969704297 4:8783681-8783703 GTGTCACATTGCCAGCTGACCGG No data
969704294_969704297 4 Left 969704294 4:8783654-8783676 CCCAGCTCTTTAATTCTCTGTCC No data
Right 969704297 4:8783681-8783703 GTGTCACATTGCCAGCTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969704297 Original CRISPR GTGTCACATTGCCAGCTGAC CGG Intergenic
No off target data available for this crispr